Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

NUTF2 cDNA

NUTF2 encoded by this gene is a cytosolic factor that facilitates protein transport into the nucleus. It interacts with the nuclear pore complex glycoprotein p62. This encoded protein acts at a relative late stage of nuclear protein import, subsequent to the initial docking of nuclear import ligand at the nuclear envelope. It is thought to be part of a multicomponent system of cytosolic factors that assemble at the pore complex during nuclear import.

Product Specifications

Product Name Alternative

Nuclear transport factor 2, NTF2, Placental protein 15, PP15, NuTF 2

Chromosomal Location

16q22.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAATGATAGAACCCAACTAGGCGCAATTTACATTGACGCGTCATGCCTTACGTGGGAAGGACAACAGTTCCAGGGGAAAGCTGCCATTGTGGAGAAGTTGTCTAGCCTTCCGTTCCAGAAAATTCAGCACAGCATCACCGCGCAGGACCATCAGCCCACTCCAGATAGCTGCATCATCAGCATGGTTGTGGGCCAGCTTAAGGCGGATGAAGACCCCATCATGGGGTTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGACATGTTCAGGCTCGCCCTGCACAACTTTGGCTGA

Additionnal Information

PP15, PP 15, Placental protein 15, NUTF2, NUTF 2, Nuclear transport factor 2, NTF2, NTF 2, ATGD0115-10 µg, ATGD0115-20 µg, ATGD0115-50 µg, ATGD0115-100 µg, ATGD0115-250 µg, ATGD0115-500 µg, ATGD0115-1 mg, ATGD0115-010, ATGD0115-020, ATGD0115-050, ATGD0115-100, ATGD0115-250, ATGD0115-500, ATGD0115-01M

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Adhesion & Movement

Omim

605813

NCBI Accession Number

NP_005787.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_005796.1

DNA Size

384bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

TMPO, NT (TMPO, LAP2, Lamina-associated polypeptide 2, isoform alpha, Thymopoietin isoform alpha, Thymopoietin-related peptide isoform alpha, Thymopoietin, Splenin, Thymopentin, TP5) (MaxLight 750) discontinued
043044-ML750 100 µL

TMPO, NT (TMPO, LAP2, Lamina-associated polypeptide 2, isoform alpha, Thymopoietin isoform alpha, Thymopoietin-related peptide isoform alpha, Thymopoietin, Splenin, Thymopentin, TP5) (MaxLight 750) discontinued

Sign In for Pricing
View Details
MYSM1 CRISPRa sgRNA lentivector (set of three targets)(Human)
31339121 3x 1.0µg DNA

MYSM1 CRISPRa sgRNA lentivector (set of three targets)(Human)

Sign In for Pricing
View Details
PL8L1 Antibody
C41310-01 40 µL

PL8L1 Antibody

Sign In for Pricing
View Details
PL8L1 Antibody
C41310-02 100 µL

PL8L1 Antibody

Sign In for Pricing
View Details
PL8L1 Antibody
C41310-03 200 µL

PL8L1 Antibody

Sign In for Pricing
View Details
Kctd12b AAV siRNA Pooled Vector
25442164 1.0 µg

Kctd12b AAV siRNA Pooled Vector

Sign In for Pricing
View Details