Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RAB34 cDNA

RAB34 encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. This gene overlaps and shares exon structure with the nine-amino acid residue-repeats (NARR) gene, which encodes a functionally distinct nucleolar protein from a different reading frame.

Product Specifications

Product Name Alternative

RAB39, RAH

Chromosomal Location

17q11.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGAACATTCTGGCACCCGTGCGGAGGGATCGCGTCCTGGCGGAGCTGCCCCAGTGCCTGAGGAAGGAGGCCGCTTTGCACGGGCACAAAGACTTCCACCCCCGCGTCACCTGCGCCTGCCAGGAGCACCGGACAGGCACCGTGGGATTTAAGATCTCCAAGGTCATTGTGGTGGGGGACCTGTCGGTGGGGAAGACTTGCCTCATTAATAGGTTCTGCAAAGACACCTTTGATAAGAATTACAAGGCCACCATTGGAGTGGACTTCGAGATGGAACGATTTGAGGTGCTGGGCATTCCCTTCAGTTTGCAGCTTTGGGATACCGCTGGGCAGGAGAGGTTCAAATGCATTGCATCAACCTACTATAGAGGAGCTCAAGCCATCATCATTGTCTTCAACCTGAATGATGTGGCATCTCTGGAACATACCAAGCAGTGGCTGGCCGATGCCCTGAAGGAGAATGACCCTTCCAGTGTGCTTCTCTTCCTTGTAGGTTCCAAGAAGGATCTGAGTACCCCTGCTCAGTATGCGCTGATGGAGAAAGACGCCCTCCAGGTGGCCCAGGAGATGAAGGCTGAGTACTGGGCAGTCTCATCTCTCACTGGTGAGAATGTCCGAGAATTCTTCTTCCGTGTGGCAGCACTGACCTTTGAGGCCAATGTGCTGGCTGAGCTGGAGAAATCGGGGGCTCGACGCATTGGGGATGTTGTCCGCATCAACAGTGATGACAGCAACCTCTACCTAACTGCCAGCAAGAAGAAGCCCACATGTTGCCCATGA

Additionnal Information

RAB34, RAB39, RAH, RAB34, ATGD0103-10 µg, ATGD0103-20 µg, ATGD0103-50 µg, ATGD0103-100 µg, ATGD0103-250 µg, ATGD0103-500 µg, ATGD0103-1 mg, ATGD0103-10, ATGD0103-20, ATGD0103-50, ATGD0103-100, ATGD0103-250, ATGD0103-500, ATGD0103-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

610917

NCBI Accession Number

NP_114140.4

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_031934.5

DNA Size

780bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Archaemetzincin 2 Overexpression Lysate (Native) - (Dry Ice)
NBP2-11595 0.1 mg

Archaemetzincin 2 Overexpression Lysate (Native) - (Dry Ice)

Sign In for Pricing
View Details
CTGF ELISA Kit (Human)
OKEH00018-96W 96 Tests

CTGF ELISA Kit (Human)

Sign In for Pricing
View Details
FAM109A Protein Vector (Mouse) (pPM-C-HA)
19710024 500 ng

FAM109A Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details
IRX1 Rabbit pAb, IRDye 800CW conjugated
orb2874429 100 µL

IRX1 Rabbit pAb, IRDye 800CW conjugated

Sign In for Pricing
View Details
RANGE 7.90-LI - Fire-proof safety cabinet 90 minutes working cover 1 door for lithium-ion batteries pre-equipped
798-LIX2 each

RANGE 7.90-LI - Fire-proof safety cabinet 90 minutes working cover 1 door for lithium-ion batteries pre-equipped

Sign In for Pricing
View Details
CLVS1 Adenovirus (Rat)
16394056 1.0 mL

CLVS1 Adenovirus (Rat)

Sign In for Pricing
View Details