Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

PLV3-U6-MCS-shRNA-CMV-MCS-mitoDsRed-Puro

Product Specifications

Product Name Alternative

GATGCAAGTCTTGATGAGGAA

Selection Marker

Puro

Applications

Interfere with silence

Storage Temperature

37°C

Resistance in Prokaryotes

Amp

Plasmid Hos

Lentivirus, Mammalian cells

Inserted Fragment Type

ShRNA

Inserted Fragment Species

Empty vector

Fluorescent labeling

Red

Competent cells

Stbl3

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CD31 / PECAM-1 (158-2B3), CF647 conjugate, 0.1mg/mL
BNC470352-100 1x 100 µL

CD31 / PECAM-1 (158-2B3), CF647 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
CD5 (Cris-1), CF647 conjugate, 0.1mg/mL
BNC470176-500 1x 500 µL

CD5 (Cris-1), CF647 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
CD16 (C16/1045), CF568 conjugate, 0.1mg/mL
BNC681045-100 1x 100 µL

CD16 (C16/1045), CF568 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
CD11c (HC1/1), CF594 conjugate, 0.1mg/mL
BNC940152-500 1x 500 µL

CD11c (HC1/1), CF594 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Mucin 5AC (MUC5AC) (58M1), CF740 conjugate, 0.1mg/mL
BNC741003-100 1x 100 µL

Mucin 5AC (MUC5AC) (58M1), CF740 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
CD43 (84-3C1), CF594 conjugate, 0.1mg/mL
BNC940342-100 1x 100 µL

CD43 (84-3C1), CF594 conjugate, 0.1mg/mL

Sign In for Pricing
View Details