Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

Inactive ASO (in vivo) sodium

Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications

Product Specifications

UNSPSC

12352208

Target

Others

Type

Oligonucleotides

Related Pathways

Others

Field of Research

Others

Assay Protocol

https://www.medchemexpress.com/inactive-aso-in-vivo.html

Purity

92.18

Solubility

H2O : 100 mg/mL (ultrasonic)

Smiles

[CCTATAGGACTATCCAGGAA]

References & Citations

[1]McCampbell A, Cole T, Wegener AJ, et al. Antisense oligonucleotides extend survival and reverse decrement in muscle response in ALS models. J Clin Invest. 2018;128 (8) :3558-3567.

Shipping Conditions

Blue Ice

Storage Conditions

-20°C (Powder, sealed storage, away from moisture)

Scientific Category

Oligonucleotides

Clinical Information

No Development Reported

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

MUC18 / Mucin 18 / CD146 (OJ79c), CF647 conjugate, 0.1mg/mL
BNC470676-500 1x 500 µL

MUC18 / Mucin 18 / CD146 (OJ79c), CF647 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
CD81 / TAPA-1 (1.3.3.22), CF405M conjugate, 0.1mg/mL
BNC050391-100 1x 100 µL

CD81 / TAPA-1 (1.3.3.22), CF405M conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Von Willebrand Factor (3E2D10), CF640R conjugate, 0.1mg/mL
BNC400633-500 1x 500 µL

Von Willebrand Factor (3E2D10), CF640R conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Histone H1 (AE-4), CF740 conjugate, 0.1mg/mL
BNC740096-100 1x 100 µL

Histone H1 (AE-4), CF740 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
CD8 (C8/1035), CF488A conjugate, 0.1mg/mL
BNC881035-100 1x 100 µL

CD8 (C8/1035), CF488A conjugate, 0.1mg/mL

Sign In for Pricing
View Details
CD50 (ICAM-3) (186-2G9), CF488A conjugate, 0.1mg/mL
BNC880178-100 1x 100 µL

CD50 (ICAM-3) (186-2G9), CF488A conjugate, 0.1mg/mL

Sign In for Pricing
View Details