Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

NLRP3 Human shRNA Lentivirus

The NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain 3 shRNAs (Short hairpin RNA) targeting human NLRP3 driven by a U6 promoter, and a puromycin selection marker (Figures 1) . The sequences of the shRNA used are shown in Table 1.Figure 1. Schematic of the lenti-vector used to generate the NLRP3 Human shRNA Lentivirus.Table 1: List of shRNA sequences present in the NLRP3 shRNA Lentivirus.Gene TargetshRNA SequenceNLRP3GAGACTCAGGAGTCGCAATTTNLRP3GGCTGTAACATTCGGAGATTGNLRP3TCATCATTCCCGCTATCTTTC

Product Specifications

Background

NOD, LRR and pyrin domain containing 3 (NLRP3), also known as NALP3 and cryopyrin, is a pattern recognition receptor (PRR) of the NRL (NOD-like receptor) subfamily. It is involved in the detection of microbes, endogenous and exogenous stress signals. It is expressed in macrophages and when bound to PYCARD (adaptor ASC protein) forms a caspase-1 activating complex named NRLP3 inflammasome. NLRP3 detects uric acid and extracellular ATP in damaged cells, and once activated it leads to an immune response. Upon activation, NLRP3 inflammasome releases its partners HSP90 and SGT1, and binds to PYCARD and caspase-1. Caspase-1 initiates the processing and release of the pro-inflammatory cytokines IL-1β and IL-18 and gasdermin D-mediated pyroptotic cell death. Mutations in NLRP3 are known to cause autoinflammatory and neuroinflammatory diseases, such as Alzheimer’s, Parkinson’s, and prion disease. NLRP3 is the most extensively studied inflammasome protein to date due to its array of activators and aberrant activation in several inflammatory diseases. Studies into its function and inhibition can lead to the development of therapeutic avenues for the treatment of auto-inflammatory diseases.

Applications

Generate a NLRP3 knockdown cell pool following puromycinGenerate a NLRP3 knockdown cell line following puromycin selection and limiting dilution.

Shipping Conditions

-80°C

Storage Conditions

Lentiviruses are shipped with dry ice. For long-term storage, it is recommended to store the lentiviruses at -80°C for up to 12 months from date of receipt. Avoid repeated freeze/thaw cycles. Titers can drop significantly with each freeze/thaw cycle.

Notes

To generate a NLRP3 knockdown stable cell line, remove the growth medium 48 hours after transduction and replace it with fresh growth medium containing the appropriate amount of puromycin (as pre-determined from a killing curve, https://bpsbioscience.com/cell-line-faq), for antibiotic selection of transduced cells, following by clonal selection.BiosafetyThe lentiviruses are produced with a SIN (self-inactivation) lentivector which ensures self-inactivation of the lentiviral construct after transduction and after integration into the genomic DNA of the target cells. None of the HIV genes (gag, pol, rev) will be expressed in the transduced cells, as they are expressed from packaging plasmids lacking the packing signal and are not present in the lentivirus particle. Although the pseudotyped lentiviruses are replication-incompetent, they require the use of a Biosafety Level 2 facility. BPS Bioscience recommends following all local federal, state, and institutional regulations and using all appropriate safety precautions.Troubleshooting GuideVisitbpsbioscience.com/lentivirus-faqfor detailed troubleshooting instructions. For all further questions, please email[email protected]

Formulation

The lentivirus particles were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS. Virus particles can be packaged in custom formulations by special request, for an additional fee.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

rac-trans Paroxol
TRC-P205795-5G 5 g

rac-trans Paroxol

Sign In for Pricing
View Details
Floor Standing Shaking Incubator BSFT-1803
BSFT-1803 1 Unit

Floor Standing Shaking Incubator BSFT-1803

Sign In for Pricing
View Details
Wdr54 Mouse Gene Knockout Kit (CRISPR)
KN519369 1 Kit

Wdr54 Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
Ubiquitin (Autophagy Marker) (UBB/1748), Biotin conjugate, 0.1mg/mL
BNCB1748-100 1x 100 µL

Ubiquitin (Autophagy Marker) (UBB/1748), Biotin conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Lysozyme (LYZ) Mouse Monoclonal Antibody (Biotin conjugated) [Clone ID: OTI1D8]
TA506192AM 100 µL

Lysozyme (LYZ) Mouse Monoclonal Antibody (Biotin conjugated) [Clone ID: OTI1D8]

Sign In for Pricing
View Details
2-Benzoylpyridine
TRC-B209570-25G 25 g

2-Benzoylpyridine

Sign In for Pricing
View Details