Bepirovirsen
Bepirovirsen, an antisense oligonucleotide, targets all HBV messenger RNAs, resulting in decreased levels of HBV-derived RNAs, HBV DNA, and viral proteins. It is utilized in researching chronic HBV infection. The binding site sequence of Bepirovirsen is (GCACTTCGCTTCACCTCTGC) .
Product Specifications
CAS Number
1403787-62-1
Field of Research
Infectious Disease & Virology
Purity
98.00%
Bioactivity
Bepirovirsen, an antisense oligonucleotide, targets all HBV messenger RNAs, resulting in decreased levels of HBV-derived RNAs, HBV DNA, and viral proteins. It is utilized in researching chronic HBV infection. The binding site sequence of Bepirovirsen is (GCACTTCGCTTCACCTCTGC) [1].
Molecular Weight
7344
Storage Conditions
-20°C
Notes
For research use only.
Available Sizes
Frequently Asked Questions
More Discoveries
Explore Other Products
Browse additional items from our catalog
NBP3-08953AF594 100 µL
Mouse Monoclonal Cyclin D1 Antibody (rCCND1/4752) [Alexa Fluor 594]
Sign In for Pricing
View Details 
227132-PE 100 µL
PSA (Prostate-Specific antigen, Kallikrein 3, KLK3) (PE)
Sign In for Pricing
View Details 
A09965-1-Cy3 100 µg/Vial
Anti-CHCHD6 Antibody Picoband® Cy3 Conjugated
Sign In for Pricing
View Details