What is the catalog number for Bepirovirsen?

The catalog number for Bepirovirsen is orb1982825.

What sizes are available for Bepirovirsen?

Bepirovirsen is available in the following size(s): 1 mg, 5 mg.

How many pack sizes does Bepirovirsen come in?

Bepirovirsen is available in 2 different pack sizes.

Is Bepirovirsen in stock?

Bepirovirsen is currently made to order / not held in immediate stock. Contact us for lead time.

Bepirovirsen

Bepirovirsen, an antisense oligonucleotide, targets all HBV messenger RNAs, resulting in decreased levels of HBV-derived RNAs, HBV DNA, and viral proteins. It is utilized in researching chronic HBV infection. The binding site sequence of Bepirovirsen is (GCACTTCGCTTCACCTCTGC) .

Product Specifications

CAS Number

1403787-62-1

Field of Research

Infectious Disease & Virology

Purity

98.00%

Bioactivity

Bepirovirsen, an antisense oligonucleotide, targets all HBV messenger RNAs, resulting in decreased levels of HBV-derived RNAs, HBV DNA, and viral proteins. It is utilized in researching chronic HBV infection. The binding site sequence of Bepirovirsen is (GCACTTCGCTTCACCTCTGC) [1].