Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD164 protein

Recombinant CD164 protein

Product Specifications

UniProt

Q04900

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Immunology & Inflammation

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~24kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

GATAAGAACACCACCCAGCATCCGAATGTGACCACCCTGGCACCGATTAGTAATGTTACCAGTGCACCGGTGACCAGTCTGCCGCTGGTTACCACCCCGGCACCGGAAACCTGTGAAGGTCGTAATAGTTGTGTTAGCTGCTTCAATGTGAGCGTGGTGAATACCACCTGCTTCTGGATTGAATGCAAAGATGAAAGCTATTGTAGCCATAATAGCACCGTTAGCGATTGCCAGGTGGGCAATACCACCGACTTCTGTAGTGTTAGTACCGCCACCCCGGTTCCGACCGCAAATAGCACCGCCAAACCGACCGTGCAGCCGAGTCCGAGCACCACCAGCAAAACCGTTACCACCAGCGGCACCACCAATAATACCGTGACCCCGACCAGTCAGCCGGTTCGTAAAAGCACCTTCGAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Olfr955 (NM_207141) Mouse Untagged Clone
MC213438 10 µg

Olfr955 (NM_207141) Mouse Untagged Clone

Sign In for Pricing
View Details
BAD, Phosphorylated (S57) (Bcl2 antagonist of cell death,BAD,BBC6, BCL2L8) (MaxLight 750)
MBS6277403-01 0.1 mL

BAD, Phosphorylated (S57) (Bcl2 antagonist of cell death,BAD,BBC6, BCL2L8) (MaxLight 750)

Sign In for Pricing
View Details
BAD, Phosphorylated (S57) (Bcl2 antagonist of cell death,BAD,BBC6, BCL2L8) (MaxLight 750)
MBS6277403-02 5x 0.1 mL

BAD, Phosphorylated (S57) (Bcl2 antagonist of cell death,BAD,BBC6, BCL2L8) (MaxLight 750)

Sign In for Pricing
View Details
Recombinant Murine Exodus-2/CCL21
P1507-.005 5 µg

Recombinant Murine Exodus-2/CCL21

Sign In for Pricing
View Details
Mouse Low Density Lipoprotein Receptor Related Protein 8, LRP8 GENLISA ELISA
KLM0835 96 Well

Mouse Low Density Lipoprotein Receptor Related Protein 8, LRP8 GENLISA ELISA

Sign In for Pricing
View Details
Skin Lysate (14 Days Old)
orb1672770 0.1 mg

Skin Lysate (14 Days Old)

Sign In for Pricing
View Details