Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD158j protein

Recombinant CD158j protein

Product Specifications

UniProt

P43631

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Immunology & Inflammation

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~30kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

CATGAAGGCGTGCATCGCAAACCGAGTCTGCTGGCACATCCGGGTCCGCTGGTGAAAAGCGAAGAAACCGTTATTCTGCAGTGCTGGAGTGATGTGCGCTTCGAACACTTCCTGCTGCATCGTGAAGGTAAATATAAAGATACCCTGCATCTGATTGGCGAACATCATGATGGTGTGAGTAAAGCCAACTTCAGTATTGGTCCGATGATGCAGGATCTGGCAGGTACCTATCGTTGTTATGGCAGCGTTACCCATAGCCCGTATCAGCTGAGTGCACCGAGTGATCCGCTGGATATTGTGATTACCGGTCTGTATGAAAAACCGAGTCTTAGCGCACAGCCGGGTCCGACCGTGCTGGCAGGTGAAAGTGTGACCCTGAGTTGCAGTAGTCGCAGCAGCTATGATATGTATCATCTGAGCCGCGAAGGCGAAGCACATGAACGCCGCTTCAGCGCCGGCCCGAAAGTTAATGGCACCTTCCAGGCAGACTTCCCGCTGGGTCCGGCAACCCATGGTGGCACCTATCGTTGCTTCGGCAGCTTCCGTGATAGCCCGTATGAATGGAGTAATAGTAGCGATCCGCTGCTGGTTAGCGTGACCGGTAATCCGAGCAATAGCTGGCCGAGCCCGACCGAACCGAGCAGTAAAACCGGTAATCCTCGTCATCTGCAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rat Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit
MBS2706468-01 24 Strip Well

Rat Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit

Sign In for Pricing
View Details
Rat Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit
MBS2706468-02 48 Well

Rat Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit

Sign In for Pricing
View Details
Rat Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit
MBS2706468-03 96 Well

Rat Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit

Sign In for Pricing
View Details
Rat Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit
MBS2706468-04 5x 96 Well

Rat Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit

Sign In for Pricing
View Details
Rat Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit
MBS2706468-05 10x 96 Well

Rat Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit

Sign In for Pricing
View Details
THBS1 Rabbit pAb, PE-Cy5.5 conjugated
orb2892840 100 µL

THBS1 Rabbit pAb, PE-Cy5.5 conjugated

Sign In for Pricing
View Details