Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD137 protein

Recombinant CD137 protein

Product Specifications

UniProt

Q07011

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Immunology & Inflammation

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~24kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

CTGCAGGATCCGTGTAGCAATTGCCCGGCAGGTACCTTCTGTGATAATAATCGCAATCAGATCTGTAGCCCGTGTCCGCCGAATAGCTTCAGTAGCGCCGGCGGTCAGCGCACCTGTGATATCTGTCGCCAGTGTAAAGGCGTGTTCCGTACCCGTAAAGAATGCAGCAGCACCAGTAATGCCGAATGTGATTGTACCCCGGGCTTCCATTGCCTGGGCGCAGGTTGTAGCATGTGTGAACAGGATTGCAAACAGGGTCAGGAACTGACCAAAAAAGGCTGTAAAGATTGCTGCTTCGGTACCTTCAATGATCAGAAACGCGGTATCTGTCGTCCGTGGACCAATTGCAGCCTGGATGGCAAAAGTGTTCTGGTTAATGGTACCAAAGAACGTGATGTTGTGTGCGGTCCGAGTCCGGCAGATCTGAGCCCGGGCGCAAGCAGTGTGACCCCGCCTGCTCCGGCACGTGAACCGGGTCATAGTCCGCAG

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

CRYZ CRISPRa sgRNA lentivector (set of three targets)(Rat)
16897126 3x 1.0µg DNA

CRYZ CRISPRa sgRNA lentivector (set of three targets)(Rat)

Sign In for Pricing
View Details
IFNL1 protein, Human, Recombinant (His)
E51P90636 20 µg

IFNL1 protein, Human, Recombinant (His)

Sign In for Pricing
View Details
LILRB1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1215302 1.0 µg DNA

LILRB1 sgRNA CRISPR Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
Recombinant Arthrobacter chlorophenolicus Peptide chain release factor 2 (prfB)
MBS1196595-01 0.02 mg (E-Coli)

Recombinant Arthrobacter chlorophenolicus Peptide chain release factor 2 (prfB)

Sign In for Pricing
View Details
Recombinant Arthrobacter chlorophenolicus Peptide chain release factor 2 (prfB)
MBS1196595-02 0.02 mg (Yeast)

Recombinant Arthrobacter chlorophenolicus Peptide chain release factor 2 (prfB)

Sign In for Pricing
View Details
Recombinant Arthrobacter chlorophenolicus Peptide chain release factor 2 (prfB)
MBS1196595-03 0.1 mg (E-Coli)

Recombinant Arthrobacter chlorophenolicus Peptide chain release factor 2 (prfB)

Sign In for Pricing
View Details