Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD9 protein

Recombinant CD9 protein

Product Specifications

UniProt

P21926

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Immunology & Inflammation

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~9kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

AGTCATAAGGATGAAGTGATTAAGGAAGTGCAGGAATTCTATAAAGATACCTATAATAAGCTGAAGACCAAAGATGAACCGCAGCGTGAAACCTTAAAAGCAATTCATTATGCCCTGAATTGCTGTGGTCTGGCAGGTGGCGTGGAACAGTTCATTAGTGATATCTGTCCGAAAAAAGATGTTCTGGAAACCTTCACCGTTAAAAGCTGCCCGGATGCCATTAAAGAAGTGTTCGATAATAAATTCCACATC

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human CCK knockout cell line
ABC-KH2591 1 Vial

Human CCK knockout cell line

Sign In for Pricing
View Details
Mouse PDGFC (Platelet Derived Growth Factor C) ELISA Kit
EM22874 96 Tests

Mouse PDGFC (Platelet Derived Growth Factor C) ELISA Kit

Sign In for Pricing
View Details
CACNA2D1 (NM_001302890) Human Untagged Clone
SC335255 10 µg

CACNA2D1 (NM_001302890) Human Untagged Clone

Sign In for Pricing
View Details
Human Nuclear receptor corepressor 1 (NCOR1) ELISA Kit
abx253821 96 Well

Human Nuclear receptor corepressor 1 (NCOR1) ELISA Kit

Sign In for Pricing
View Details
HLX Polyclonal Antibody
E-AB-66047-01 60 µL

HLX Polyclonal Antibody

Sign In for Pricing
View Details
HLX Polyclonal Antibody
E-AB-66047-02 120 µL

HLX Polyclonal Antibody

Sign In for Pricing
View Details