Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD63 protein

Recombinant CD63 protein

Product Specifications

UniProt

P08962

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Immunology & Inflammation

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~11kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

GCTGGTTATGTGTTCCGTGATAAAGTTATGAGCGAATTCAATAATAACTTCCGTCAGCAGATGGAAAATTATCCGAAAAATAATCACACCGCAAGCATTCTGGATCGCATGCAGGCCGACTTCAAATGTTGTGGCGCAGCAAATTATACCGATTGGGAAAAAATTCCGAGCATGAGCAAAAATCGTGTGCCGGATAGCTGCTGCATTAATGTTACCGTTGGTTGCGGTATTAACTTCAATGAAAAAGCCATTCATAAGGAAGGTTGCGTTGAAAAAATTGGTGGTTGGCTGCGTAAAAATGTT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)
MBS1191421-01 0.02 mg (E-Coli)

Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)

Sign In for Pricing
View Details
Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)
MBS1191421-02 0.02 mg (Yeast)

Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)

Sign In for Pricing
View Details
Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)
MBS1191421-03 0.1 mg (E-Coli)

Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)

Sign In for Pricing
View Details
Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)
MBS1191421-04 0.1 mg (Yeast)

Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)

Sign In for Pricing
View Details
Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)
MBS1191421-05 0.02 mg (Baculovirus)

Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)

Sign In for Pricing
View Details
Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)
MBS1191421-06 0.02 mg (Mammalian-Cell)

Recombinant Enterobacter sp. UPF0176 protein Ent638_1569 (Ent638_1569)

Sign In for Pricing
View Details