Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD3E protein

Recombinant CD3E protein

Product Specifications

UniProt

P07766

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Immunology & Inflammation

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~18kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

GATGGTAATGAAGAAATGGGCGGTATTACCCAGACCCCGTATAAAGTTAGTATTAGTGGCACCACCGTTATTCTGACCTGTCCGCAGTATCCGGGTAGCGAAATTCTGTGGCAGCATAATGATAAAAATATCGGCGGTGATGAAGATGATAAAAATATTGGTAGCGATGAAGATCATCTGAGTCTGAAAGAATTCAGTGAACTGGAACAGAGCGGTTATTATGTGTGTTATCCGCGCGGTAGTAAACCGGAAGATGCCAACTTCTATCTGTATCTGCGTGCACGCGTGTGTGAAAATTGTATGGAAATGGAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Polyclonal C9orf163 Antibody [Alexa Fluor 750]
NBP3-06061AF750 0.1 mL

Rabbit Polyclonal C9orf163 Antibody [Alexa Fluor 750]

Sign In for Pricing
View Details
PHKA1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1641602 1.0 µg DNA

PHKA1 sgRNA CRISPR Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
RFK Protein Vector (Mouse) (pPB-N-His)
PV223655 500 ng

RFK Protein Vector (Mouse) (pPB-N-His)

Sign In for Pricing
View Details
ADH5P2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0049602 1.0 µg DNA

ADH5P2 sgRNA CRISPR Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
Mouse Monoclonal CD117/c-kit Antibody (47233) [DyLight 350]
FAB332D 0.1 mL

Mouse Monoclonal CD117/c-kit Antibody (47233) [DyLight 350]

Sign In for Pricing
View Details
RAP1A/1B discontinued
R1120-20 40 µg

RAP1A/1B discontinued

Sign In for Pricing
View Details