Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD320 protein

Recombinant CD320 protein

Product Specifications

UniProt

Q9NPF0

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Immunology & Inflammation

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~27kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

AGTCCGCTGAGTACCCCGACCAGCGCCCAGGCAGCCGGTCCTAGTAGCGGCAGCTGTCCGCCGACCAAATTCCAGTGCCGTACCAGTGGTCTGTGTGTTCCGCTGACCTGGCGTTGCGATCGTGATCTGGATTGCAGCGATGGCAGCGATGAAGAAGAATGCCGTATTGAACCGTGTACCCAGAAAGGCCAGTGCCCGCCGCCGCCTGGTCTGCCTTGTCCTTGCACCGGCGTTAGTGATTGTAGCGGCGGCACCGATAAAAAACTGCGCAATTGCAGCCGTCTGGCCTGTCTGGCAGGTGAACTGCGTTGCACCCTGAGTGATGATTGCATTCCGCTGACCTGGCGCTGTGATGGTCATCCGGATTGCCCGGATAGTAGCGATGAACTGGGTTGTGGCACCAATGAAATTCTGCCGGAAGGTGATGCCACCACCATGGGTCCGCCGGTTACCCTGGAAAGCGTGACCAGCCTGCGCAATGCAACCACCATGGGCCCGCCGGTTACACTGGAAAGCGTTCCGAGCGTTGGTAATGCAACCAGCAGTAGCGCCGGCGATCAGAGTGGCAGTCCGACCGCATAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Kcnh1 (NM_010600) Mouse Tagged Lenti ORF Clone
MR219363L3 10 µg

Kcnh1 (NM_010600) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Lentiviral mouse Adam22 shRNA (UAS) - Lentiviral mouse Adam22 shRNA (UAS) plasmid
GTR15174847 1 Vial

Lentiviral mouse Adam22 shRNA (UAS) - Lentiviral mouse Adam22 shRNA (UAS) plasmid

Sign In for Pricing
View Details
AGFG2 (NM_006076) Human Over-expression Lysate
LY401830 100 µg

AGFG2 (NM_006076) Human Over-expression Lysate

Sign In for Pricing
View Details
Rabbit Polyclonal AHR Antibody
NBP1-89974-25ul 25 µL

Rabbit Polyclonal AHR Antibody

Sign In for Pricing
View Details
Bovine Ovarian cancer G-protein coupled receptor 1, GPR68 ELISA Kit
MBS9325898-01 48 Well

Bovine Ovarian cancer G-protein coupled receptor 1, GPR68 ELISA Kit

Sign In for Pricing
View Details
Bovine Ovarian cancer G-protein coupled receptor 1, GPR68 ELISA Kit
MBS9325898-02 96 Well

Bovine Ovarian cancer G-protein coupled receptor 1, GPR68 ELISA Kit

Sign In for Pricing
View Details