Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD302 protein

Recombinant CD302 protein

Product Specifications

UniProt

Q8IX05

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Immunology & Inflammation

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~17kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

GATTGCCCGAGTAGTACCTGGATTCAGTTCCAGGATAGCTGTTATATCTTCCTGCAGGAAGCCATTAAAGTTGAAAGCATTGAAGATGTGCGTAATCAGTGCACCGATCATGGCGCCGATATGATTAGTATTCATAATGAAGAAGAGAACGCATTCATTCTGGATACCCTGAAAAAACAGTGGAAAGGTCCGGATGATATTCTGCTGGGTATGTTCTATGATACCGATGATGCCAGCTTCAAATGGTTCGATAATAGTAATATGACCTTCGATAAGTGGACCGATCAGGATGATGATGAAGATCTGGTGGATACCTGCGCATTCCTGCATATTAAAACCGGCGAATGGAAAAAAGGTAATTGCGAAGTTAGTAGCGTGGAAGGTACCCTGTGTAAAACCGCAATTCCGTATAAACGCAAATATCTGAGCGATAATCAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CNNM3 antibody
70R-16477 50 μL

CNNM3 antibody

Sign In for Pricing
View Details
Lentiviral mouse Trappc6b shRNA (UAS) - Lentiviral mouse Trappc6b shRNA (UAS, RFP) (25)
GTR15285323 1 Vial

Lentiviral mouse Trappc6b shRNA (UAS) - Lentiviral mouse Trappc6b shRNA (UAS, RFP) (25)

Sign In for Pricing
View Details
TP73, Phosphorylated (Y99) (Tumor Protein p73, P73) (MaxLight 490)
MBS6441418-01 0.1 mL

TP73, Phosphorylated (Y99) (Tumor Protein p73, P73) (MaxLight 490)

Sign In for Pricing
View Details
TP73, Phosphorylated (Y99) (Tumor Protein p73, P73) (MaxLight 490)
MBS6441418-02 5x 0.1 mL

TP73, Phosphorylated (Y99) (Tumor Protein p73, P73) (MaxLight 490)

Sign In for Pricing
View Details
N-[ (4-Methoxyphenyl) methyl]prop-2-enamide
VCA87553-01 50 mg

N-[ (4-Methoxyphenyl) methyl]prop-2-enamide

Sign In for Pricing
View Details
N-[ (4-Methoxyphenyl) methyl]prop-2-enamide
VCA87553-02 0.5 g

N-[ (4-Methoxyphenyl) methyl]prop-2-enamide

Sign In for Pricing
View Details