Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD123 protein

Recombinant CD123 protein

Product Specifications

UniProt

O75794

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Immunology & Inflammation

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~45kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

AAGAAGGAACATGTGCTGCATTGCCAGTTCAGCGCCTGGTATCCGTTCTTCCGTGGTGTTACCATTAAAAGCGTGATTCTGCCGCTGCCGCAGAATGTTAAAGATTATCTGCTGGATGATGGTACCCTGGTTGTTAGCGGCCGCGATGATCCGCCGACCCATAGTCAGCCGGATAGTGATGATGAAGCAGAAGAAATTCAGTGGAGTGATGATGAGAATACCGCCACCCTGACCGCCCCGGAATTCCCGGAATTCGCAACCAAAGTGCAGGAAGCCATTAATAGCCTGGGTGGTAGTGTGTTCCCGAAACTGAATTGGAGTGCACCGCGTGATGCATATTGGATTGCCATGAATAGTAGCCTGAAATGTAAAACCTTAAGCGATATCTTCCTGCTGTTCAAAAGTAGTGACTTCATTACCCGTGACTTCACCCAGCCGTTCATTCATTGTACCGATGATAGTCCGGATCCGTGTATTGAATATGAACTGGTGCTGCGTAAATGGTGCGAACTGATTCCGGGCGCAGAATTCCGCTGCTTCGTTAAAGAAAATAAACTGATTGGTATCAGCCAGCGTGATTATACCCAGTATTATGATCATATTAGCAAGCAGAAAGAGGAAATTCGTCGCTGCATTCAGGACTTCTTCAAAAAACATATTCAGTATAAGTTCCTGGACGAAGACTTCGTGTTCGATATCTATCGCGATAGTCGCGGTAAAGTGTGGCTGATTGACTTCAATCCGTTCGGTGAAGTTACCGATAGCCTGCTGTTCACCTGGGAAGAACTGATTAGTGAAAATAATCTGAACGGCGACTTCAGCGAAGTTGATGCACAGGAACAGGATAGCCCGGCCTTCCGTTGTACCAATAGTGAAGTTACCGTTCAGCCGAGTCCGTATCTGAGTTATCGTCTGCCGAAAGACTTCGTGGATCTGAGCACCGGCGAAGATGCACATAAACTGATTGACTTCCTGAAACTGAAACGTAATCAGCAGGAAGATGAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

GPR176 (Probable G-Protein Coupled Receptor 176, HB-954, HB954) discontinued
223035-01 50 µL

GPR176 (Probable G-Protein Coupled Receptor 176, HB-954, HB954) discontinued

Sign In for Pricing
View Details
GPR176 (Probable G-Protein Coupled Receptor 176, HB-954, HB954) discontinued
223035-02 100 µL

GPR176 (Probable G-Protein Coupled Receptor 176, HB-954, HB954) discontinued

Sign In for Pricing
View Details
Gallus Interleukin 15 (IL15) ELISA Kit
MBS2700979-01 24 Strip Well

Gallus Interleukin 15 (IL15) ELISA Kit

Sign In for Pricing
View Details
Gallus Interleukin 15 (IL15) ELISA Kit
MBS2700979-02 48 Well

Gallus Interleukin 15 (IL15) ELISA Kit

Sign In for Pricing
View Details
Gallus Interleukin 15 (IL15) ELISA Kit
MBS2700979-03 96 Well

Gallus Interleukin 15 (IL15) ELISA Kit

Sign In for Pricing
View Details
Gallus Interleukin 15 (IL15) ELISA Kit
MBS2700979-04 5x 96 Well

Gallus Interleukin 15 (IL15) ELISA Kit

Sign In for Pricing
View Details