Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD8B protein

Recombinant CD8B protein

Product Specifications

UniProt

P10966

Expression Region

Pet-22b (+)

Tag

His-tag

Field of Research

Epigenetics, Immunology

Concentration

> 0.5mg/ml

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~18kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only.

Applications Notes

NdeI-XhoI

Preservative

PBS, 4M Urea, pH 7.4

AA Sequence

CTGCAGCAGACCCCGGCTTATATTAAAGTTCAGACCAATAAAATGGTGATGCTGAGCTGCGAAGCAAAAATTAGTCTGAGCAATATGCGCATCTATTGGCTGCGCCAGCGCCAGGCACCGAGTAGTGATAGTCATCATGAATTCCTGGCCCTGTGGGATAGCGCCAAAGGTACCATTCATGGCGAAGAAGTGGAACAGGAAAAAATTGCCGTGTTCCGTGATGCCAGCCGCTTCATTCTGAATCTGACCAGCGTTAAACCGGAAGATAGTGGCATCTACTTCTGCATGATTGTTGGCAGTCCGGAACTGACCTTCGGCAAAGGTACCCAGCTGAGCGTTGTTGACTTCCTGCCGACCACCGCACAGCCGACCAAAAAAAGTACCCTGAAAAAACGTGTGTGCCGCCTGCCGCGCCCGGAAACACAGAAAGGTCCGCTGTGCAGTCCG

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Capn15 ELISA Kit
EF016225 96 Tests

Mouse Capn15 ELISA Kit

Sign In for Pricing
View Details
Recombinant Human NUP50 Protein - (Dry Ice)
H00010762-P01-10ug 10 µg

Recombinant Human NUP50 Protein - (Dry Ice)

Sign In for Pricing
View Details
Srp54a sgRNA CRISPR Lentivector set (Rat)
K7068501 3x 1.0 µg

Srp54a sgRNA CRISPR Lentivector set (Rat)

Sign In for Pricing
View Details
Shank2 AAV siRNA Pooled Vector
43691166 1.0 µg

Shank2 AAV siRNA Pooled Vector

Sign In for Pricing
View Details
DP1 Transcription Factor (BSA & Azide Free) (AP) discontinued
D4010-01X-AP 100 µL

DP1 Transcription Factor (BSA & Azide Free) (AP) discontinued

Sign In for Pricing
View Details
LINGO2 Antibody
E19-10178-1 50 µg - 50 µL

LINGO2 Antibody

Sign In for Pricing
View Details