Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

TMSB4X

Product Specifications

Sequence

ATGTCTGACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAACTGAAGAAGACAGAGACGCAAGAGAAAAATCCACTGCCTTCCAAAGAAACGATTGAACAGGAGAAGCAAGCAGGCGAATCGTAA

Length

135

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

PCR-STEC Detection Kit
K1452-96 96 Reactions

PCR-STEC Detection Kit

Sign In for Pricing
View Details
LYVE1 antibody
70R-LR006 0.2 mg

LYVE1 antibody

Sign In for Pricing
View Details
ARRDC2 Protein Vector (Rat) (pPM-C-His)
PV254729 500 ng

ARRDC2 Protein Vector (Rat) (pPM-C-His)

Sign In for Pricing
View Details
Human KRT15 protein
orb753351-01 50 µg

Human KRT15 protein

Sign In for Pricing
View Details
Human KRT15 protein
orb753351-02 100 µg

Human KRT15 protein

Sign In for Pricing
View Details
Human KRT15 protein
orb753351-03 200 µg

Human KRT15 protein

Sign In for Pricing
View Details