Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

TMSB4X

Product Specifications

Sequence

ATGTCTGACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAACTGAAGAAGACAGAGACGCAAGAGAAAAATCCACTGCCTTCCAAAGAAACGATTGAACAGGAGAAGCAAGCAGGCGAATCGTAA

Length

135

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

ZBTB44 Recombinant Protein (Human)
RP035161 100 µg

ZBTB44 Recombinant Protein (Human)

Sign In for Pricing
View Details
TREML4 Rabbit Polyclonal Antibody
orb326897 100 µL

TREML4 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Hemoglobin subunit zeta/HBAZ, Human (His)
HY-P70242-01 10 µg

Hemoglobin subunit zeta/HBAZ, Human (His)

Sign In for Pricing
View Details
Hemoglobin subunit zeta/HBAZ, Human (His)
HY-P70242-02 50 µg

Hemoglobin subunit zeta/HBAZ, Human (His)

Sign In for Pricing
View Details
C10orf46 Antibody Blocking peptide
orb1449322 500 µg

C10orf46 Antibody Blocking peptide

Sign In for Pricing
View Details
Rat phosphorylated Signal Transducer And Activator Of Transcription 5 (p-STAT5) ELISA Kit
YP-W37649-01 48 Tests

Rat phosphorylated Signal Transducer And Activator Of Transcription 5 (p-STAT5) ELISA Kit

Sign In for Pricing
View Details