Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

PLXNB1

Product Specifications

Sequence

ATGCCATTCCGGCACAAGCCTGGGAGTGTGTTCTCCGTGGAGGGGGAGAACCTGGACCTTGCAATGTCCAAGGAGGAGGTGGTGGCTATGATAGGGGATGGCCCCTGTGTGGTGAAGACGCTGACGCGGCACCACCTGTACTGCGAGCCCCCCGTGGAGCAGCCCCTGCCACGGCACCATGCCCTCCGAGAGGCACCTGACTCTTTGCCTGAGTTCACGGTCAGTGGGCAGGTCCCTGGCCGGGCTGGGCATTGA

Length

255

More Discoveries

Explore Other Products

Browse additional items from our catalog

ARFGEF2 Human Recombinant Protein
TP725140 50 µg

ARFGEF2 Human Recombinant Protein

Sign In for Pricing
View Details
Mouse Delta Like 1 Homolog (dLK1) ELISA Kit
RDR-dLK1-Mu-96Tests 96 Tests

Mouse Delta Like 1 Homolog (dLK1) ELISA Kit

Sign In for Pricing
View Details
Monkey CKLFSF8 (Chemokine Like Factor Superfamily 8) ELISA Kit
MBS2515467-01 24 Tests

Monkey CKLFSF8 (Chemokine Like Factor Superfamily 8) ELISA Kit

Sign In for Pricing
View Details
Monkey CKLFSF8 (Chemokine Like Factor Superfamily 8) ELISA Kit
MBS2515467-02 48 Test

Monkey CKLFSF8 (Chemokine Like Factor Superfamily 8) ELISA Kit

Sign In for Pricing
View Details
Monkey CKLFSF8 (Chemokine Like Factor Superfamily 8) ELISA Kit
MBS2515467-03 96 Tests

Monkey CKLFSF8 (Chemokine Like Factor Superfamily 8) ELISA Kit

Sign In for Pricing
View Details
Monkey CKLFSF8 (Chemokine Like Factor Superfamily 8) ELISA Kit
MBS2515467-04 5x 96 Tests

Monkey CKLFSF8 (Chemokine Like Factor Superfamily 8) ELISA Kit

Sign In for Pricing
View Details