Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

HSD11B1L

Product Specifications

Sequence

ATGAAGGTGCTTCTCCTCACAGGGCTGGGGGCCCTGTTCTTCGCCTATTATTGGGATGACAACTTCGACCCAGCCAGCCTCCAGGGAGCGCGAGTGCTGCTGACAGGGGCCAACGCTGGTGTTGGTGAGGAGCTGGCCTATCACTACGCGCGTCTGGGCTCCCACCTGGTGCTCACTGCCCACACTGAGGCTCTCCTGCAGAAGGCACGGTGGCTCACGCTTGTAGTCAGCACTTTGGGAGGCCGAGGAAAGTGGATCACCTGA

Length

264

More Discoveries

Explore Other Products

Browse additional items from our catalog

Lentiviral mouse Fbxo22 shRNA (UAS) - Lentiviral mouse Fbxo22 shRNA (UAS, GFP) (100)
GTR15259929 1 Vial

Lentiviral mouse Fbxo22 shRNA (UAS) - Lentiviral mouse Fbxo22 shRNA (UAS, GFP) (100)

Sign In for Pricing
View Details
Goat Anti-Rabbit IgG (H+L) pAb, HRP-conjugated
E40SA2143 100 µL

Goat Anti-Rabbit IgG (H+L) pAb, HRP-conjugated

Sign In for Pricing
View Details
Nalidixic Acid NA 30 mcg
SD021-1VL 1 unit

Nalidixic Acid NA 30 mcg

Sign In for Pricing
View Details
Anti-Zebrafish CLPXa/b Antibody Picoband® Fluoro647 Conjugated
AZA0A8M9QBU1-Fluoro647 100 µg/Vial

Anti-Zebrafish CLPXa/b Antibody Picoband® Fluoro647 Conjugated

Sign In for Pricing
View Details
CTNNA3 (NM_013266) Human Tagged Lenti ORF Clone
RC213265L2 10 µg

CTNNA3 (NM_013266) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Recombinant Human CUZD1 Protein, N-GST
orb2831875-01 20 µg

Recombinant Human CUZD1 Protein, N-GST

Sign In for Pricing
View Details