Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SH3BGRL2

Product Specifications

Sequence

ATGGTCATCCGCGTGTTCGTCGCCTCTTCCTCGGGCTTCGTGGCGATAAAGAAGAAGCAGCAAGATGTGGTTAGATTTCTGGAAGCCAACAAGATAGAGTTTGAGGAGGTGGATATCACAATGTCAGAAGAACAGAGGCAATGGATGTACAAAAACGTCCCCCCGGAAAAGAAACCCACTCAGGGCAACCCCCTGCCACCTCAGATATTTAATGGCGACCGATACTGTGGAGATTATGACAGTTTTTTTGAATCCAAGGAAAGCAACACAGTCTTTTCATTTTTAGGCCTGAAACCACGGTTGGCATCAAAGGCAGAACCTTAG

Length

324

More Discoveries

Explore Other Products

Browse additional items from our catalog

PI3KC3 (S676) (Phosphatidylinositol 3-kinase catalytic subunit type 3, PtdIns-3-kinase type 3, PI3-kinase type 3, PI3K type 3, Phosphoinositide-3-kinase class 3, Phosphatidylinositol 3-kinase p100 subunit, vps34) (AP)
MBS6333574-01 0.2 mL

PI3KC3 (S676) (Phosphatidylinositol 3-kinase catalytic subunit type 3, PtdIns-3-kinase type 3, PI3-kinase type 3, PI3K type 3, Phosphoinositide-3-kinase class 3, Phosphatidylinositol 3-kinase p100 subunit, vps34) (AP)

Sign In for Pricing
View Details
PI3KC3 (S676) (Phosphatidylinositol 3-kinase catalytic subunit type 3, PtdIns-3-kinase type 3, PI3-kinase type 3, PI3K type 3, Phosphoinositide-3-kinase class 3, Phosphatidylinositol 3-kinase p100 subunit, vps34) (AP)
MBS6333574-02 5x 0.2 mL

PI3KC3 (S676) (Phosphatidylinositol 3-kinase catalytic subunit type 3, PtdIns-3-kinase type 3, PI3-kinase type 3, PI3K type 3, Phosphoinositide-3-kinase class 3, Phosphatidylinositol 3-kinase p100 subunit, vps34) (AP)

Sign In for Pricing
View Details
Recombinant Photorhabdus luminescens subsp. laumondii Tryptophan synthase alpha chain (trpA)
MBS1400042-01 0.02 mg (E-Coli)

Recombinant Photorhabdus luminescens subsp. laumondii Tryptophan synthase alpha chain (trpA)

Sign In for Pricing
View Details
Recombinant Photorhabdus luminescens subsp. laumondii Tryptophan synthase alpha chain (trpA)
MBS1400042-02 0.02 mg (Yeast)

Recombinant Photorhabdus luminescens subsp. laumondii Tryptophan synthase alpha chain (trpA)

Sign In for Pricing
View Details
Recombinant Photorhabdus luminescens subsp. laumondii Tryptophan synthase alpha chain (trpA)
MBS1400042-03 0.1 mg (E-Coli)

Recombinant Photorhabdus luminescens subsp. laumondii Tryptophan synthase alpha chain (trpA)

Sign In for Pricing
View Details
Recombinant Photorhabdus luminescens subsp. laumondii Tryptophan synthase alpha chain (trpA)
MBS1400042-04 0.1 mg (Yeast)

Recombinant Photorhabdus luminescens subsp. laumondii Tryptophan synthase alpha chain (trpA)

Sign In for Pricing
View Details