Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RPS27L

Product Specifications

Sequence

ATGTGCCAGCGTTGTGGTTTAAAACTAATAGTAATAATATGCTTCTTTGTTCAGTTGGCTAGAGATTTACTACATCCGTCCTTGGAAGAGGAAAAGAAAAAACATAAAAAGAAACGCCTAGTACAAAGTCCAAATTCTTACTTTATGGATGTAAAATGTCCAGGTTGCTACAAGATCACCACGGTTTTCAGCCATGCTCAGACAGTGGTTCTTTGTGTAGGTTGTTCAACAGTGTTGTGCCAGCCTACAGGAGGAAAGGCCAGACTCACAGAAGGTATATCATTTGGCATTCTCCAACCCAGTGATGAGATTGATGATTATAAATGTCTCTATCTTCACTGA

Length

342

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Olr1559 Protein Vector (Rat) (pPM-C-HA)
PV288560 500 ng

Olr1559 Protein Vector (Rat) (pPM-C-HA)

Sign In for Pricing
View Details
Starch Assay Kit (Colorimetric)
MBS169281-01 100 Assays

Starch Assay Kit (Colorimetric)

Sign In for Pricing
View Details
Starch Assay Kit (Colorimetric)
MBS169281-02 5x 100 Assays

Starch Assay Kit (Colorimetric)

Sign In for Pricing
View Details
RGD1565257 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6327305 3x 1.0 µg

RGD1565257 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

Sign In for Pricing
View Details
Rabbit Monoclonal GDF-3 Antibody (010) [Alexa Fluor 594]
NBP2-89220AF594 0.1 mL

Rabbit Monoclonal GDF-3 Antibody (010) [Alexa Fluor 594]

Sign In for Pricing
View Details
2,2-bis (3,5-dibromo-4- (2,3-dibromopropoxy) phenyl) propane
sc-335315B 100 g

2,2-bis (3,5-dibromo-4- (2,3-dibromopropoxy) phenyl) propane

Sign In for Pricing
View Details