Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

FTO

Product Specifications

Sequence

ATGGAGTGGAGGAAAGTCAGCGAATGTAATAGTGTCGAACCCTGCAGGGAAGTTAAGAAGTGGCCATACCGTTGCATTCATCATGGGAAGAATTTCAGTAGAATGACAAATGCTGTGCTTCATGAAGTTAAAAGAGAGGGGCTCCCCGTGGAACAAAGGAATGAAATCTTGACTGCCATCCTTGCCTCGCTCACTGCACGCCAGAACCTGAGGAGAGAATGGCATGCCAGGTGCCAGTCACGAATTGCCCGAACATTACCTGCTGATCAGAAGCCAGAATGTCGGCCATACTGGGAAAAGGATGATGCTTCGATGCCTCTGCCGTTTGACCTCACAGACATCGTTTCAGAACTCAGAGGTCAGCTTCTGGAAGCAAAACCCTAG

Length

384

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Foxi2 Immunizing Peptide
MBS426168-01 0.1 mg

Foxi2 Immunizing Peptide

Sign In for Pricing
View Details
Foxi2 Immunizing Peptide
MBS426168-02 5x 0.1 mg

Foxi2 Immunizing Peptide

Sign In for Pricing
View Details
Goat Apoptotic Factor Receptor 1 Elisa kit
GTR10410901 96 Well

Goat Apoptotic Factor Receptor 1 Elisa kit

Sign In for Pricing
View Details
BSCL2 CRISPRa sgRNA lentivector (set of three targets)(Rat)
13501126 3x 1.0µg DNA

BSCL2 CRISPRa sgRNA lentivector (set of three targets)(Rat)

Sign In for Pricing
View Details
Pig Glutathione Peroxidase 3 (GPX3) ELISA Kit
MBS2707608-01 24 Strip Well

Pig Glutathione Peroxidase 3 (GPX3) ELISA Kit

Sign In for Pricing
View Details
Pig Glutathione Peroxidase 3 (GPX3) ELISA Kit
MBS2707608-02 48 Well

Pig Glutathione Peroxidase 3 (GPX3) ELISA Kit

Sign In for Pricing
View Details