Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

FHAD1

Product Specifications

Sequence

ATGGTTGAAGAGACTCAGAAAACAAAGGCAACTGAAAGTCTAAAAGCAGAGAGCCTCGCCTTGAAATTAAATGAAACATTAGCCGAACTGGAAACTACCAAGACAAAAATGATCATGGTGGAAGAGCGGCTAATCCTGCAGCAGAAGATGGTAAAGGCCCTCCAGGATGAGCAGGAATCACAGAGACACGGGTTTGAAGAAGAGATCATGGAATATAAGGAGCAAATCAAACAGCACGCCCAGACAATTGTGAGCCTCGAAGAGAAACTCCAGAAAGTCACTCAGCACCATAAAAAAATAGAAGGCGAGATTGCAACATTGAAGGACAATGACCCAGCCCCAAAGGAGGAAAGGCCGCAAGACCCTCTGGTGGCTCCCATGACAGAGAGCAGTGCCAAAGACATGGCGTACGAACATCTGATTGAGTCTACAAAGAAGTCTATCCTCAAAGAACTGACAGTTTTCAGAGAAACAAACGTATGA

Length

483

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Mouse Osteonectin (ON)
RPU43159-01 50 µg

Recombinant Mouse Osteonectin (ON)

Sign In for Pricing
View Details
Recombinant Mouse Osteonectin (ON)
RPU43159-02 100 µg

Recombinant Mouse Osteonectin (ON)

Sign In for Pricing
View Details
Recombinant Mouse Osteonectin (ON)
RPU43159-03 1 mg

Recombinant Mouse Osteonectin (ON)

Sign In for Pricing
View Details
Recombinant Human Eukaryotic peptide chain release factor GTP-binding subunit ERF3A (GSPT1)
orb1646456-01 20 µg

Recombinant Human Eukaryotic peptide chain release factor GTP-binding subunit ERF3A (GSPT1)

Sign In for Pricing
View Details
Recombinant Human Eukaryotic peptide chain release factor GTP-binding subunit ERF3A (GSPT1)
orb1646456-02 100 µg

Recombinant Human Eukaryotic peptide chain release factor GTP-binding subunit ERF3A (GSPT1)

Sign In for Pricing
View Details
Recombinant Human Eukaryotic peptide chain release factor GTP-binding subunit ERF3A (GSPT1)
orb1646456-03 1 mg

Recombinant Human Eukaryotic peptide chain release factor GTP-binding subunit ERF3A (GSPT1)

Sign In for Pricing
View Details