Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SCGB2A2

Product Specifications

Sequence

ATGAAGTTGCTGATGGTCCTCATGCTGGCGGCCCTCTCCCAGCACTGCTACGCAGGCTCTGGCTGCCCCTTATTGGAGAATGTGATTTCCAAGACAATCAATCCACAAGTGTCTAAGACTGAATACAAAGAACTTCTTCAAGAGTTCATAGACGACAATGCCACTACAAATGCCATAGATGAATTGAAGGAATGTTTTCTTAACCAAACGGATGAAACTCTGAGCAATGTTGAGGTGTTTATGCAATTAATATATGACAGCAGTCTTTGTGATTTATTTTAA

Length

282

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Polyclonal HVEM/TNFRSF14 Antibody [Biotin]
NBP1-76689B 0.1 mL

Rabbit Polyclonal HVEM/TNFRSF14 Antibody [Biotin]

Sign In for Pricing
View Details
Tripeptidyl peptidase II Overexpression Lysate (Native) - (Dry Ice)
NBL1-17224 0.1 mg

Tripeptidyl peptidase II Overexpression Lysate (Native) - (Dry Ice)

Sign In for Pricing
View Details
Ptpn22 (NM_001106460) Rat Tagged Lenti ORF Clone
RR204259L3 10 µg

Ptpn22 (NM_001106460) Rat Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Rnf185 3'UTR Lenti-reporter-Luc Vector
40276086 1.0 µg

Rnf185 3'UTR Lenti-reporter-Luc Vector

Sign In for Pricing
View Details
EED Rabbit Polyclonal Antibody (Cy5.5)
orb1058875 100 µL

EED Rabbit Polyclonal Antibody (Cy5.5)

Sign In for Pricing
View Details
Pkmyt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4821902 1.0 µg DNA

Pkmyt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

Sign In for Pricing
View Details