Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SCGB2A2

Product Specifications

Sequence

ATGAAGTTGCTGATGGTCCTCATGCTGGCGGCCCTCTCCCAGCACTGCTACGCAGGCTCTGGCTGCCCCTTATTGGAGAATGTGATTTCCAAGACAATCAATCCACAAGTGTCTAAGACTGAATACAAAGAACTTCTTCAAGAGTTCATAGACGACAATGCCACTACAAATGCCATAGATGAATTGAAGGAATGTTTTCTTAACCAAACGGATGAAACTCTGAGCAATGTTGAGGTGTTTATGCAATTAATATATGACAGCAGTCTTTGTGATTTATTTTAA

Length

282

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Human Galectin-4
7-00440 25 µg

Recombinant Human Galectin-4

Sign In for Pricing
View Details
Sec14l4 (NM_146013) Mouse Tagged ORF Clone Lentiviral Particle
MR206328L3V 200 µL

Sec14l4 (NM_146013) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Anti-CD110/MPL Polyclonal Antibody
PHE26201 100 μg

Anti-CD110/MPL Polyclonal Antibody

Sign In for Pricing
View Details
BATF CRISPR All-in-one AAV vector set (with saCas9)(Mouse)
13023154 3x 1.0 µg DNA

BATF CRISPR All-in-one AAV vector set (with saCas9)(Mouse)

Sign In for Pricing
View Details
HSP90B1 Antibody
orb252117 100 µL

HSP90B1 Antibody

Sign In for Pricing
View Details
GSK3 alpha antibody
MBS5309650-01 0.05 mg

GSK3 alpha antibody

Sign In for Pricing
View Details