Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

FAM153C

Product Specifications

Sequence

ATGGTGGACAAAGACACAGAGAGAGACATTGAGATGAAACGGCAACTACGGCGACTACGGGAGCTCCACCTATACAGCACATGGAAGAAGTACCAAGAGGCGATGAAGACATCCTTGGGAGTTCCACAACGTGGTGACCTGGAAGACCTGGAGGAGCATCTGCCAGGGCAGACAGTCTCTGAGGAAGCCACAGGGGTTCACATGATGCAGGTGGACCCAGCCACACCGGCAAAGAAATTGGAAGACTCCACCATTACAGGCAGCCACCAGCAGATGTCAGCAAGTCCTTCCTCTGCACCTGCAGAAGAAGCAACAGAAAAGACCAAAGTGGAAGAGGAAGTGAAAACCAGAAAGCCCAAGAAGAAAACCAGGAAGCCCAGCAAGAAAAGCCGGTGGAATGTCCTGAAATGTTGGGACATTTTTAATATATTTTAG

Length

435

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Olr466 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7381203 1.0 µg DNA

Olr466 sgRNA CRISPR Lentivector (Rat) (Target 2)

Sign In for Pricing
View Details
Brca1 Mouse qPCR Primer Pair (NM_009764)
MP201419 200 Reactions

Brca1 Mouse qPCR Primer Pair (NM_009764)

Sign In for Pricing
View Details
TCHH sgRNA CRISPR Lentivector (Human) (Target 2)
K2350203 1.0 µg DNA

TCHH sgRNA CRISPR Lentivector (Human) (Target 2)

Sign In for Pricing
View Details
Anti-CREB
DB-168-0.1 100 µl

Anti-CREB

Sign In for Pricing
View Details
Dectin-2 Protein, Human, Recombinant (hFc)
TMPY-03173-01 5 µg

Dectin-2 Protein, Human, Recombinant (hFc)

Sign In for Pricing
View Details
Dectin-2 Protein, Human, Recombinant (hFc)
TMPY-03173-02 10 µg

Dectin-2 Protein, Human, Recombinant (hFc)

Sign In for Pricing
View Details