Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CDX1

Product Specifications

Sequence

ATGTGCTGGACAAGGATTCGCCCGGGCACACCGTCCTCGCCCGGAGCGCAGAGGCGGACGCCCTACGAGTGGATGCGGCGCAGCGTGGCGGCCGGAGGCGGCGGTGGCAGCGGTAAGACTCGGACCAAGGACAAGTACCGCGTGGTCTACACCGACCACCAACGCCTGGAGCTGGAGAAGGAGTTTCATTACAGCCGTTACATCACAATCCGGCGGAAATCAGAGCTGGCTGCCAATCTGGGGCTCACTGAACGGCAGGTGAAGATCTGGTTCCAAAACCGGCGGGCAAAGGAGCGCAAAGTGAACAAGAAGAAACAGCAGCAGCAACAGCCCCCACAGCCGCCGATGGCCCACGACATCACGGCCACCCCAGCCGGGCCATCCCTGGGGGGCCTGTGTCCCAGCAACACCAGCCTCCTGGCCACCTCCTCTCCAATGCCTGTGAAAGAGGAGTTTCTGCCATAG

Length

465

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Human Cytokine receptor common subunit beta Protein
ARP1823-01 10 µg

Recombinant Human Cytokine receptor common subunit beta Protein

Sign In for Pricing
View Details
Recombinant Human Cytokine receptor common subunit beta Protein
ARP1823-02 50 µg

Recombinant Human Cytokine receptor common subunit beta Protein

Sign In for Pricing
View Details
Recombinant Human Cytokine receptor common subunit beta Protein
ARP1823-03 100 µg

Recombinant Human Cytokine receptor common subunit beta Protein

Sign In for Pricing
View Details
Recombinant Human Cytokine receptor common subunit beta Protein
ARP1823-04 1 mg

Recombinant Human Cytokine receptor common subunit beta Protein

Sign In for Pricing
View Details
APBB3 Protein Vector (Human) (pPM-C-His)
PV048896 500 ng

APBB3 Protein Vector (Human) (pPM-C-His)

Sign In for Pricing
View Details
Lentiviral human CHST3 shRNA (UAS) - Lentiviral human CHST3 shRNA (UAS, GFP) (25)
GTR15346931 1 Vial

Lentiviral human CHST3 shRNA (UAS) - Lentiviral human CHST3 shRNA (UAS, GFP) (25)

Sign In for Pricing
View Details