Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

C5orf49

Product Specifications

Sequence

ATGGAGGACGACGAGGAGGAGACCACCGCGTCCACGCTGCGGGGCAAGCCCAGGCCGCCGCCCGTCTCGGCGCAGTCCGCCTTCAGCTACATCCCGCCGCGGCGCCTGGACCCCAAAGAGCACAGCTACTACTACCGCCCGGCGCGGACAGGAATTATTTCCCTCTATGATTGTATTTTTAAGAGGCGCCTAGATTATGATCAGAAGTTGCACCGAGATGACAGAGAACATGCAAAAAGCCTGGGACTTCATGTTAACGAAGAGGAACAGGAGAGGCCGGTTGGAGTGCTGACGTCTTCTGTCTATGGGAAGCGCATCAATCAGCCCATTGAGCCCCTAAACCGGGACTTTGGCCGTGCCAACCATGTGCAGGCTGACTTCTACAGGAAGAACGACATCCCCAGCCTCAAGGAACCCGGCTTTGGGCACATTGCTCCATCCTGA

Length

444

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

GAL4 (LGALS4) (NM_006149) Human Recombinant Protein
PROTP56470 20 µg

GAL4 (LGALS4) (NM_006149) Human Recombinant Protein

Sign In for Pricing
View Details
CPN1 Protein Vector (Human) (pPB-N-His)
PV010498 500 ng

CPN1 Protein Vector (Human) (pPB-N-His)

Sign In for Pricing
View Details
Galectin 1/Lgals1 Rabbit Polyclonal Antibody
orb402366 100 µg

Galectin 1/Lgals1 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
TOP6A3 Antibody
orb842653 2 mg

TOP6A3 Antibody

Sign In for Pricing
View Details
Lentiviral human FH shRNA (UAS) - Lentiviral human FH shRNA (UAS) (25)
GTR15131813 1 Vial

Lentiviral human FH shRNA (UAS) - Lentiviral human FH shRNA (UAS) (25)

Sign In for Pricing
View Details
Recombinant Human P4HA1 Protein, N-His
HY191012-01 50 µg

Recombinant Human P4HA1 Protein, N-His

Sign In for Pricing
View Details