Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

DUSP21

Product Specifications

Sequence

ATGACAGCATCCGCGTCCTCCTTTTCATCATCTCAGGGTGTCCAGCAGCCCTCCATCTACAGCTTCTCCCAAATAACCAGAAGCTTGTTTCTCAGCAATGGTGTGGCCGCCAACGACAAACTCCTTCTGTCCAGCAATCGCATCACCGCCATTGTCAATGCCTCGGTGGAAGTGGTCAACGTATTCTTCGAGGGCATTCAGTACATAAAGGTGCCTGTTACCGATGCTCGTGACTCGCGTCTCTACGACTTTTTTGACCCCATTGCTGATCTTATCCACACCATCGATATGAGGCAGGGCCGTACGCTGCTGCACTGCATGGCTGGAGTGAGCCGTTCCGCCTCACTGTGCCTTGCGTACCTCATGAAATACCACTCCATGTCGCTGCTGGACGCCCATACATGGACCAAGTCGCGCCGCCCCATCATCCGGCCCAACAACGGCTTTTGGGAACAGCTCATCAATTACGAATTCAAGCTGTTTAATAACAACACCGTGCGCATGATCAACTCGCCGGTAGGTAACATCCCTGACATCTATGAGAAGGACCTACGTATGATGATATCAATGTAA

Length

573

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

GPR110 (Probable G-protein Coupled Receptor 110, G-protein Coupled Receptor KPG_012, G-protein Coupled Receptor PGR19, PGR19)
170603 50 µg

GPR110 (Probable G-protein Coupled Receptor 110, G-protein Coupled Receptor KPG_012, G-protein Coupled Receptor PGR19, PGR19)

Sign In for Pricing
View Details
ARHGEF10L (Rho Guanine Nucleotide Exchange Factor 10-like Protein)
475563 100 µL

ARHGEF10L (Rho Guanine Nucleotide Exchange Factor 10-like Protein)

Sign In for Pricing
View Details
DEFB118, Recombinant, Human, aa21-123, His-Tag (Beta-Defensin 118 Precursor)
218101-01 100 µg

DEFB118, Recombinant, Human, aa21-123, His-Tag (Beta-Defensin 118 Precursor)

Sign In for Pricing
View Details
DEFB118, Recombinant, Human, aa21-123, His-Tag (Beta-Defensin 118 Precursor)
218101-02 500 µg

DEFB118, Recombinant, Human, aa21-123, His-Tag (Beta-Defensin 118 Precursor)

Sign In for Pricing
View Details
RPS21 Antibody, HRP conjugated
CSB-PA020399LB01HU-01 50 µg

RPS21 Antibody, HRP conjugated

Sign In for Pricing
View Details
RPS21 Antibody, HRP conjugated
CSB-PA020399LB01HU-02 100 µg

RPS21 Antibody, HRP conjugated

Sign In for Pricing
View Details