Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SYCN

Product Specifications

Sequence

ATGTCCCCGCTGCGCCCGCTGCTGCTGGCCCTGGCCCTTGCCTCCGTGCCTTGCGCCCAGGGCGCCTGCCCCGCCTCCGCCGACCTCAAGCACTCGGACGGGACGCGCACTTGCGCCAAGCTCTATGACAAGAGCGACCCCTACTATGAGAACTGCTGCGGGGGCGCCGAGCTGTCGCTGGAGTCGGGCGCAGACCTGCCCTACCTGCCCTCCAACTGGGCCAACACCGCCTCCTCACTTGTGGTGGCCCCGCGCTGCGAGCTCACCGTGTGGTCCCGGCAAGGCAAGGCGGGCAAGACGCACAAGTTCTCTGCCGGCACCTACCCGCGCCTGGAGGAGTACCGCCGGGGCATCTTAGGAGACTGGTCCAACGCTATCTCCGCGCTCTACTGCAGGTGCAGCTGA

Length

405

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

SIGIRR 3'UTR GFP Stable Cell Line
TU073174 1.0 mL

SIGIRR 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
RGS8 (Regulator of G-protein Signaling 8) (FITC)
MBS6401959-01 0.1 mL

RGS8 (Regulator of G-protein Signaling 8) (FITC)

Sign In for Pricing
View Details
RGS8 (Regulator of G-protein Signaling 8) (FITC)
MBS6401959-02 5x 0.1 mL

RGS8 (Regulator of G-protein Signaling 8) (FITC)

Sign In for Pricing
View Details
LB Broth, Powder
G3102-100ML 100 mL

LB Broth, Powder

Sign In for Pricing
View Details
Cdc42 3'UTR GFP Stable Cell Line
TU153562 1.0 mL

Cdc42 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
SURF6 AAV Vector (Human) (CMV)
45902101 1 µg

SURF6 AAV Vector (Human) (CMV)

Sign In for Pricing
View Details