Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SYCN

Product Specifications

Sequence

ATGTCCCCGCTGCGCCCGCTGCTGCTGGCCCTGGCCCTTGCCTCCGTGCCTTGCGCCCAGGGCGCCTGCCCCGCCTCCGCCGACCTCAAGCACTCGGACGGGACGCGCACTTGCGCCAAGCTCTATGACAAGAGCGACCCCTACTATGAGAACTGCTGCGGGGGCGCCGAGCTGTCGCTGGAGTCGGGCGCAGACCTGCCCTACCTGCCCTCCAACTGGGCCAACACCGCCTCCTCACTTGTGGTGGCCCCGCGCTGCGAGCTCACCGTGTGGTCCCGGCAAGGCAAGGCGGGCAAGACGCACAAGTTCTCTGCCGGCACCTACCCGCGCCTGGAGGAGTACCGCCGGGGCATCTTAGGAGACTGGTCCAACGCTATCTCCGCGCTCTACTGCAGGTGCAGCTGA

Length

405

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

SPTBN3 Rabbit pAb, PerCP-Cy7 conjugated
orb2848579 100 µL

SPTBN3 Rabbit pAb, PerCP-Cy7 conjugated

Sign In for Pricing
View Details
Vmn2r42 shRNA Plasmid (m)
sc-155161-SH 20 µg

Vmn2r42 shRNA Plasmid (m)

Sign In for Pricing
View Details
LC3A Recombinant Antibody, PE-Cy7 Conjugated
bsm-62899R-PE-Cy7-01 20 µL

LC3A Recombinant Antibody, PE-Cy7 Conjugated

Sign In for Pricing
View Details
LC3A Recombinant Antibody, PE-Cy7 Conjugated
bsm-62899R-PE-Cy7-02 100 µL

LC3A Recombinant Antibody, PE-Cy7 Conjugated

Sign In for Pricing
View Details
LGI1 Polyclonal Antibody, PE-Cy7 Conjugated
bs-6719R-PE-Cy7 100 µL

LGI1 Polyclonal Antibody, PE-Cy7 Conjugated

Sign In for Pricing
View Details
ENT1, phosphorylated (Ser254) (Equilibrative Nitrobenzylmercaptopurine Riboside-sensitive Nucleoside Transporter, Equilibrative NBMPR-sensitive Nucleoside Transporter, Nucleoside Transporter, es-type, Solute Carrier Family 29 Member 1, Slc29a1, Equilibrative Nucleoside Transporter 1) (MaxLight 650) discontinued
E3225-01C-ML650 100 µL

ENT1, phosphorylated (Ser254) (Equilibrative Nitrobenzylmercaptopurine Riboside-sensitive Nucleoside Transporter, Equilibrative NBMPR-sensitive Nucleoside Transporter, Nucleoside Transporter, es-type, Solute Carrier Family 29 Member 1, Slc29a1, Equilibrative Nucleoside Transporter 1) (MaxLight 650) discontinued

Sign In for Pricing
View Details