Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

BAGE

Product Specifications

Sequence

ATGGCGGCCAGAGCGGTTTTTCTGGCATTGTCTGCCCAGCTGCTCCAAGCCAGGCTGATGAAGGAGGAGTCCCCTGTGGTGAGCTGGAGGTTGGAGCCTGAAGACGGCACAGCTCTGTGCTTCATCTTCTGA

Length

132

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

UCHL3 Rabbit Polyclonal Antibody (PE-Cy7)
orb869322 100 µL

UCHL3 Rabbit Polyclonal Antibody (PE-Cy7)

Sign In for Pricing
View Details
SLC35D1 siRNA (Human)
MBS8212205-01 15 nmol

SLC35D1 siRNA (Human)

Sign In for Pricing
View Details
SLC35D1 siRNA (Human)
MBS8212205-02 30 nmol

SLC35D1 siRNA (Human)

Sign In for Pricing
View Details
SLC35D1 siRNA (Human)
MBS8212205-03 5x 30 nmol

SLC35D1 siRNA (Human)

Sign In for Pricing
View Details
Gum Ghatti Extrapure
131400500 500 mg

Gum Ghatti Extrapure

Sign In for Pricing
View Details
mmu-miR-292a-3p miRNA Inhibitor
MIM01599 2x 5.0 nmol

mmu-miR-292a-3p miRNA Inhibitor

Sign In for Pricing
View Details