Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

BEX5

Product Specifications

Sequence

ATGGAAAATGTCCCCAAGGAAAACAAAGTTGTGGAGAAGGCCCCAGTGCAGAATGAAGCCCCCGCTTTAGGAGGTGGTGAATACCAGGAGCCTGGAGGAAATGTTAAAGGGGTTTGGGCTCCACCTGCCCCGGGTTTTGGAGAGGATGTGCCCAATAGGCTTGTCGATAACATTGATATGATAGATGGAGATGGAGATGATATGGAACGGTTCATGGAGGAGATGAGAGAGCTAAGGAGGAAAATTAGGGAACTTCAGTTGAGGTACAGTCTGCGCATTCTTATAGGGGACCCTCCTCACCATGATCATCATGATGAGTTTTGCCTTATGCCTTGA

Length

336

More Discoveries

Explore Other Products

Browse additional items from our catalog

XpressTM Human TPBG Over-expressing Cell Line (HepG2)
ABC-X0256C 1 Vial

XpressTM Human TPBG Over-expressing Cell Line (HepG2)

Sign In for Pricing
View Details
ATP6V0A4, ID (ATP6V0A4, ATP6N1B, ATP6N2, V-type proton ATPase 116kD subunit a isoform 4, Vacuolar proton translocating ATPase 116kD subunit a isoform 4, Vacuolar proton translocating ATPase 116kD subunit a kidney isoform) (Biotin)
MBS6276625-01 0.2 mL

ATP6V0A4, ID (ATP6V0A4, ATP6N1B, ATP6N2, V-type proton ATPase 116kD subunit a isoform 4, Vacuolar proton translocating ATPase 116kD subunit a isoform 4, Vacuolar proton translocating ATPase 116kD subunit a kidney isoform) (Biotin)

Sign In for Pricing
View Details
ATP6V0A4, ID (ATP6V0A4, ATP6N1B, ATP6N2, V-type proton ATPase 116kD subunit a isoform 4, Vacuolar proton translocating ATPase 116kD subunit a isoform 4, Vacuolar proton translocating ATPase 116kD subunit a kidney isoform) (Biotin)
MBS6276625-02 5x 0.2 mL

ATP6V0A4, ID (ATP6V0A4, ATP6N1B, ATP6N2, V-type proton ATPase 116kD subunit a isoform 4, Vacuolar proton translocating ATPase 116kD subunit a isoform 4, Vacuolar proton translocating ATPase 116kD subunit a kidney isoform) (Biotin)

Sign In for Pricing
View Details
EBV NA1 (aa 1 - 90, 408 - 498) [GST]
DAG2362 100 µg

EBV NA1 (aa 1 - 90, 408 - 498) [GST]

Sign In for Pricing
View Details
Multiple organ cancer and normal tissue test array, including pathology grade, TNM and clinical stage, 6 cases/24 cores
MMO247 6 Cases / 24 Cores

Multiple organ cancer and normal tissue test array, including pathology grade, TNM and clinical stage, 6 cases/24 cores

Sign In for Pricing
View Details
Biotin-Linked Polyclonal Antibody to Motilin (MTL)
MBS2113162-01 0.1 mL

Biotin-Linked Polyclonal Antibody to Motilin (MTL)

Sign In for Pricing
View Details