Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CRYGA

Product Specifications

Sequence

ATGAGCGTCCCAATTACCAGGGCCACCAGTACTTCCTGCGCCGAGACCAGCTCGCACAAGTTAAGGCTGTACGAGAGAGATGACTACCGAGGCCTTATGTCTGAGCTCACTGATGACTGCGCCTGTGTTCCAGAACTGTTCCGTCTCCCTGAGATCTATTCCCTCCACGTACTGGAGGGCTGCTGGGTCCTCTATGAAATGCCCAACTACCGGGGGCGGCAGTATCTGCTGAGGCCTGGGGACTACAGAAGGTACCACGACTGGGGGGGTGCAGATGCCAAAGTCGGCTCTTTGAGACGGGTCACCGATTTGTACTAA

Length

318

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

HEY2 Rabbit pAb, Pacific Blue conjugated
orb2884735 100 µL

HEY2 Rabbit pAb, Pacific Blue conjugated

Sign In for Pricing
View Details
4- (2-Aminoethoxy) benzoic acid hydrochloride
ASB20810-01 0.5 g

4- (2-Aminoethoxy) benzoic acid hydrochloride

Sign In for Pricing
View Details
4- (2-Aminoethoxy) benzoic acid hydrochloride
ASB20810-02 5 g

4- (2-Aminoethoxy) benzoic acid hydrochloride

Sign In for Pricing
View Details
Recombinant Drosophila virilis Protein enhancer of rudimentary (e (r))
MBS1364425-01 0.02 mg (E-Coli)

Recombinant Drosophila virilis Protein enhancer of rudimentary (e (r))

Sign In for Pricing
View Details
Recombinant Drosophila virilis Protein enhancer of rudimentary (e (r))
MBS1364425-02 0.1 mg (E-Coli)

Recombinant Drosophila virilis Protein enhancer of rudimentary (e (r))

Sign In for Pricing
View Details
Recombinant Drosophila virilis Protein enhancer of rudimentary (e (r))
MBS1364425-03 0.02 mg (Yeast)

Recombinant Drosophila virilis Protein enhancer of rudimentary (e (r))

Sign In for Pricing
View Details