Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CRYGA

Product Specifications

Sequence

ATGAGCGTCCCAATTACCAGGGCCACCAGTACTTCCTGCGCCGAGACCAGCTCGCACAAGTTAAGGCTGTACGAGAGAGATGACTACCGAGGCCTTATGTCTGAGCTCACTGATGACTGCGCCTGTGTTCCAGAACTGTTCCGTCTCCCTGAGATCTATTCCCTCCACGTACTGGAGGGCTGCTGGGTCCTCTATGAAATGCCCAACTACCGGGGGCGGCAGTATCTGCTGAGGCCTGGGGACTACAGAAGGTACCACGACTGGGGGGGTGCAGATGCCAAAGTCGGCTCTTTGAGACGGGTCACCGATTTGTACTAA

Length

318

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Neurexin 3/NRXN3 Antibody
orb20010 100 µg

Neurexin 3/NRXN3 Antibody

Sign In for Pricing
View Details
BMG (Beta-2-Microglobulin) BioAssayTM ELISA Kit (Rat) discontinued
354275-01 48 Tests

BMG (Beta-2-Microglobulin) BioAssayTM ELISA Kit (Rat) discontinued

Sign In for Pricing
View Details
BMG (Beta-2-Microglobulin) BioAssayTM ELISA Kit (Rat) discontinued
354275-02 96 Tests

BMG (Beta-2-Microglobulin) BioAssayTM ELISA Kit (Rat) discontinued

Sign In for Pricing
View Details
Human Sortilin (SORT1) ELISA Kit
orb1947262-01 48 Tests

Human Sortilin (SORT1) ELISA Kit

Sign In for Pricing
View Details
Human Sortilin (SORT1) ELISA Kit
orb1947262-02 96 Tests

Human Sortilin (SORT1) ELISA Kit

Sign In for Pricing
View Details
NAB1 (NM_005966) Human Over-expression Lysate
LS004664 100 µg

NAB1 (NM_005966) Human Over-expression Lysate

Sign In for Pricing
View Details