Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

ADIG

Product Specifications

Sequence

ATGAAGTACCCTTTGATGCCGCTGGTGAACGACCTCACATTTTCTTTCCTGGTTTTCTGGTTCTGCCTCCCTGTGGGTTTGCTGTTGTTATTGATCATCTGGCTACGCTTCTTACTTAGCCAAGATTCAGAGGAAAATGACTCCAGTGTGTGCTTGGATTGGGAGCCCTGGAGCAAAGGCCCAGCTGAGTTTTGCTGGAAGGGGACACTCCACGGCCAAGAGAAGGAGAGGCCCTGCTGGTGA

Length

243

More Discoveries

Explore Other Products

Browse additional items from our catalog

RNF113B (A-8)
sc-518257 200 µg/mL

RNF113B (A-8)

Sign In for Pricing
View Details
Slc41a3 3'UTR GFP Stable Cell Line
TU169144 1.0 mL

Slc41a3 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
IGHV3OR16-10 sgRNA CRISPR Lentivector set (Human)
K1042001 3x 1.0 µg

IGHV3OR16-10 sgRNA CRISPR Lentivector set (Human)

Sign In for Pricing
View Details
PNMA3 Polyclonal Antibody, Cy5.5 Conjugated
bs-24044R-Cy5.5 100 µL

PNMA3 Polyclonal Antibody, Cy5.5 Conjugated

Sign In for Pricing
View Details
TRP53INP1 siRNA (Mouse)
CRM6252-01 15 nmol

TRP53INP1 siRNA (Mouse)

Sign In for Pricing
View Details
TRP53INP1 siRNA (Mouse)
CRM6252-02 30 nmol

TRP53INP1 siRNA (Mouse)

Sign In for Pricing
View Details