Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

GDEP

Product Specifications

Sequence

ATGTGCTGTGAAATCTACTACCGTTTGCTGGTTTTGAAAATGGAGAAAAAGAGTGAGGAACTGAGAAACATGGATGGCCTTGGGAACGTGGAAAAGGGTCACTGA

Length

105

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Schisantherin D
PCA91782-01 5 mg

Schisantherin D

Sign In for Pricing
View Details
Schisantherin D
PCA91782-02 10 mg

Schisantherin D

Sign In for Pricing
View Details
Schisantherin D
PCA91782-03 25 mg

Schisantherin D

Sign In for Pricing
View Details
Schisantherin D
PCA91782-04 50 mg

Schisantherin D

Sign In for Pricing
View Details
Canine Growth Differentiation Factor 6 ELISA Kit
MBS741591-01 48 Well

Canine Growth Differentiation Factor 6 ELISA Kit

Sign In for Pricing
View Details
Canine Growth Differentiation Factor 6 ELISA Kit
MBS741591-02 96 Well

Canine Growth Differentiation Factor 6 ELISA Kit

Sign In for Pricing
View Details