Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

GDEP

Product Specifications

Sequence

ATGTGCTGTGAAATCTACTACCGTTTGCTGGTTTTGAAAATGGAGAAAAAGAGTGAGGAACTGAGAAACATGGATGGCCTTGGGAACGTGGAAAAGGGTCACTGA

Length

105

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

FBXO4 (FBX4, F-box Only Protein 4, DKFZp547N213, FLJ10141) (MaxLight 490)
MBS6378268-01 0.1 mL

FBXO4 (FBX4, F-box Only Protein 4, DKFZp547N213, FLJ10141) (MaxLight 490)

Sign In for Pricing
View Details
FBXO4 (FBX4, F-box Only Protein 4, DKFZp547N213, FLJ10141) (MaxLight 490)
MBS6378268-02 5x 0.1 mL

FBXO4 (FBX4, F-box Only Protein 4, DKFZp547N213, FLJ10141) (MaxLight 490)

Sign In for Pricing
View Details
Doublecortin (F6K9E) Rabbit Monoclonal Antibody (BSA and Azide Free)
CST 48679SF 100 µg

Doublecortin (F6K9E) Rabbit Monoclonal Antibody (BSA and Azide Free)

Sign In for Pricing
View Details
Phosphoric Acid Dibenzyl Ester
019645 100 mg

Phosphoric Acid Dibenzyl Ester

Sign In for Pricing
View Details
Human KIZ qPCR Primer Pair
QH46041S 200 Tests

Human KIZ qPCR Primer Pair

Sign In for Pricing
View Details
HnRNP U Recombinant Antibody, Cy5 Conjugated
bsm-61823R-Cy5-TR 20 µL

HnRNP U Recombinant Antibody, Cy5 Conjugated

Sign In for Pricing
View Details