Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

HIST1H2BH

Product Specifications

Sequence

ATGCCTGATCCAGCTAAGTCCGCTCCCGCCCCGAAGAAGGGCTCCAAGAAGGCGGTGACCAAGGCGCAGAAGAAGGATGGCAAGAAGCGTAAACGCAGCCGCAAGGAGAGCTACTCCGTATACGTTTACAAGGTGCTGAAGCAAGTCCACCCCGACACCGGCATCTCCTCCAAAGCCATGGGGATCATGAATTCCTTTGTCAACGATATCTTCGAGCGCATCGCCGGCGAGGCTTCCCGCCTGGCTCATTACAACAAGCGTTCGACCATCACCTCCAGGGAGATCCAGACAGCCGTGCGCCTGCTGCTGCCTGGGGAACTGGCCAAGCACGCCGTGTCCGAGGGCACTAAGGCCGTCACCAAGTACACCAGCTCCAAATAA

Length

381

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

NPC1 (Niemann-Pick C1 Protein) (MaxLight 405) discontinued
130491-ML405 100 µL

NPC1 (Niemann-Pick C1 Protein) (MaxLight 405) discontinued

Sign In for Pricing
View Details
FNDC8 (NM_017559) Human Recombinant Protein
E45H39440M5 20 µg

FNDC8 (NM_017559) Human Recombinant Protein

Sign In for Pricing
View Details
Suomilide
orb1691365 25 mg

Suomilide

Sign In for Pricing
View Details
MGC114427 (Magea9) (NM_001024893) Rat Tagged ORF Clone Lentiviral Particle
RR213755L4V 200 µL

MGC114427 (Magea9) (NM_001024893) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
PRDM2 Antibody, HRP conjugated
MBS7050056-01 0.05 mg

PRDM2 Antibody, HRP conjugated

Sign In for Pricing
View Details
PRDM2 Antibody, HRP conjugated
MBS7050056-02 0.1 mg

PRDM2 Antibody, HRP conjugated

Sign In for Pricing
View Details