Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

WFDC10B

Product Specifications

Sequence

ATGGCACCCCAGACTCTGCTGCCTGTCCTGGTTCTCTGTGTGCTGCTGCTGCAGGCCCAGGGAGGATACCGTGACAAGATGAGGATGCAGAGAATCAAGGTCTGTGAGAAGCGACCCAGCATAGATCTATGCATCCACCACTGTTCATATTTCCAAAAGTGTGAAACAAATAAGATATGCTGTTCAGCCTTCTGTGGGAACATTTGTATGAGCATCCTATGA

Length

222

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

AKT3 Antibody
BF0236-01 50 µL

AKT3 Antibody

Sign In for Pricing
View Details
AKT3 Antibody
BF0236-02 100 µL

AKT3 Antibody

Sign In for Pricing
View Details
AKT3 Antibody
BF0236-03 200 µL

AKT3 Antibody

Sign In for Pricing
View Details
Recombinant Salmonella typhi Threonine--tRNA ligase (thrS), partial
MBS1469408 Inquire

Recombinant Salmonella typhi Threonine--tRNA ligase (thrS), partial

Sign In for Pricing
View Details
1-[2- (Trifluoromethyl) phenyl]piperazine hydrochloride
FT93381-01 1 mg

1-[2- (Trifluoromethyl) phenyl]piperazine hydrochloride

Sign In for Pricing
View Details
1-[2- (Trifluoromethyl) phenyl]piperazine hydrochloride
FT93381-02 5 mg

1-[2- (Trifluoromethyl) phenyl]piperazine hydrochloride

Sign In for Pricing
View Details