Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MUCL1

Product Specifications

Sequence

ATGAAGTTCTTAGCAGTCCTGGTACTCTTGGGAGTTTCCATCTTTCTGGTCTCTGCCCAGAATCCGACAACAGCTGCTCCAGCTGACACGTATCCAGCTACTGGTCCTGCTGATGATGAAGCCCCTGATGCTGAAACCACTGCTGCTGCAACCACTGCGACCACTGCTGCTCCTACCACTGCAACCACCGCTGCTTCTACCACTGCTCGTAAAGACATTCCAGTTTTACCCAAATGGGTTGGGGATCTCCCGAATGGTAGAGTGTGTCCCTGA

Length

273

More Discoveries

Explore Other Products

Browse additional items from our catalog

Fcho2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3286307 1.0 µg DNA

Fcho2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

Sign In for Pricing
View Details
PDK4-IN-1
MBS5767309 Inquire

PDK4-IN-1

Sign In for Pricing
View Details
ATP5A1P7 Protein Vector (Human) (pPB-C-His)
PV063785 500 ng

ATP5A1P7 Protein Vector (Human) (pPB-C-His)

Sign In for Pricing
View Details
Mouse Aldehyde Dehydrogenase 9 Family, Member A1 (ALDH9A1) ELISA Kit
orb780582-01 48 Tests

Mouse Aldehyde Dehydrogenase 9 Family, Member A1 (ALDH9A1) ELISA Kit

Sign In for Pricing
View Details
Mouse Aldehyde Dehydrogenase 9 Family, Member A1 (ALDH9A1) ELISA Kit
orb780582-02 96 Tests

Mouse Aldehyde Dehydrogenase 9 Family, Member A1 (ALDH9A1) ELISA Kit

Sign In for Pricing
View Details
Cytochrome P450 3A43 Antibody
MBS9605040-01 0.1 mL

Cytochrome P450 3A43 Antibody

Sign In for Pricing
View Details