Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MUCL1

Product Specifications

Sequence

ATGAAGTTCTTAGCAGTCCTGGTACTCTTGGGAGTTTCCATCTTTCTGGTCTCTGCCCAGAATCCGACAACAGCTGCTCCAGCTGACACGTATCCAGCTACTGGTCCTGCTGATGATGAAGCCCCTGATGCTGAAACCACTGCTGCTGCAACCACTGCGACCACTGCTGCTCCTACCACTGCAACCACCGCTGCTTCTACCACTGCTCGTAAAGACATTCCAGTTTTACCCAAATGGGTTGGGGATCTCCCGAATGGTAGAGTGTGTCCCTGA

Length

273

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human SLC36A2 activation kit by CRISPRa
GA115854 1 Kit

Human SLC36A2 activation kit by CRISPRa

Sign In for Pricing
View Details
BCL3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0176002 1.0 µg DNA

BCL3 sgRNA CRISPR Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
Anti-APLP1 Antibody Picoband® Fluoro488 Conjugated
PB9476-Fluoro488 100 µg/Vial

Anti-APLP1 Antibody Picoband® Fluoro488 Conjugated

Sign In for Pricing
View Details
Human CXorf30 shRNA Plasmid
abx968502-01 150 µg

Human CXorf30 shRNA Plasmid

Sign In for Pricing
View Details
Human CXorf30 shRNA Plasmid
abx968502-02 300 µg

Human CXorf30 shRNA Plasmid

Sign In for Pricing
View Details
ERLEC1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV651914 1.0 µg DNA

ERLEC1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

Sign In for Pricing
View Details