Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SPRR2A

Product Specifications

Sequence

ATGTCTTATCAACAGCAGCAGTGCAAGCAGCCCTGCCAGCCACCTCCTGTGTGCCCCACGCCAAAGTGCCCAGAACCATGTCCACCCCCGAAGTGCCCTGAGCCCTGCCCACCACCAAAGTGTCCACAGCCCTGCCCACCTCAGCAGTGCCAGCAGAAATATCCTCCTGTGACACCTTCCCCACCCTGCCAGTCAAAGTATCCACCGAAGAGCAAGTAA

Length

219

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rafivirumab (RV)
592138 100 µg

Rafivirumab (RV)

Sign In for Pricing
View Details
Phospho-Bad (Ser134) Polyclonal Antibody, AbBy Fluor™ 555 Conjugated
bs-5217R-BF555-TR 20 µL

Phospho-Bad (Ser134) Polyclonal Antibody, AbBy Fluor™ 555 Conjugated

Sign In for Pricing
View Details
Angiotensin A (Human) - FAM Labeled
FG-002-36A 1 nmol

Angiotensin A (Human) - FAM Labeled

Sign In for Pricing
View Details
Pronethalol hydrochloride
MBS5757653 Inquire

Pronethalol hydrochloride

Sign In for Pricing
View Details
Classic CRISPR sgRNA Synthesis Kit, BioGenomicsTM discontinued
500567 25 Tests

Classic CRISPR sgRNA Synthesis Kit, BioGenomicsTM discontinued

Sign In for Pricing
View Details
Recombinant Human RPAP1 Protein
E30P2712 20 µg

Recombinant Human RPAP1 Protein

Sign In for Pricing
View Details