Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CRCT1

Product Specifications

Sequence

ATGTCCTCTCAACAGAGCGCCGTTTCCGCCAAAGGCTTTTCCAAGGGGTCGTCCCAGGGCCCCGCTCCGTGTCCCGCCCCGGCGCCCACCCCGGCGCCCGCCTCCTCCTCCTCCTGCTGTGGCTCCGGCAGGGGCTGCTGCGGCGACTCAGGCTGCTGCGGCTCCAGCTCCACCAGTTGCTGCTGCTTCCCAAGGAGACGCCGTCGACAGCGGAGTAGTGGTTGCTGCTGCTGCGGGGGCGGCAGCCAGAGGTCCCAGCGCTCCAACAACCGGAGCTCAGGATGCTGCTCCGGCTGCTGA

Length

300

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Anti-Human Ribosomal Protein L40 Polyclonal Antibody
PA90686HU-01 50 µg

Rabbit Anti-Human Ribosomal Protein L40 Polyclonal Antibody

Sign In for Pricing
View Details
Rabbit Anti-Human Ribosomal Protein L40 Polyclonal Antibody
PA90686HU-02 100 µg

Rabbit Anti-Human Ribosomal Protein L40 Polyclonal Antibody

Sign In for Pricing
View Details
Rabbit Anti-Human Ribosomal Protein L40 Polyclonal Antibody
PA90686HU-03 500 µg

Rabbit Anti-Human Ribosomal Protein L40 Polyclonal Antibody

Sign In for Pricing
View Details
Rabbit Anti-Human Ribosomal Protein L40 Polyclonal Antibody
PA90686HU-04 1 mg

Rabbit Anti-Human Ribosomal Protein L40 Polyclonal Antibody

Sign In for Pricing
View Details
Human PPP1R12A qPCR Primer Pair
QH04329S 200 Tests

Human PPP1R12A qPCR Primer Pair

Sign In for Pricing
View Details
Olfr1339 (NM_146852) Mouse Untagged Clone
MC213991 10 µg

Olfr1339 (NM_146852) Mouse Untagged Clone

Sign In for Pricing
View Details