Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

KRTAP19-5

Product Specifications

Sequence

ATGAACTACTACGGCAACTACTATGGAGGCCTGGGCTACGGCTACGGAGGCTTCGATGACCTGGGCTATGGCTATGGCTGTGGATGTGGCAGCTTCCGCAGACTGGGCTATGGCGGTGGCTACGGAGGCTACGGATACGGCTCTGGCTTCGGAGGCTATGGATACCGCAGCTGCCGTCCATCATGCTATGGAGGATATGGATTCTCTGGATTTTATTGA

Length

219

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

RIC8A Antibody Blocking peptide
orb1454139 500 µg

RIC8A Antibody Blocking peptide

Sign In for Pricing
View Details
TMPRSS4, Control Peptide (Transmembrane Protease Serine 4, Channel-activating Protease 2, CAPH2, Membrane-type Serine Protease 2, MT-SP2, TMPRSS3, UNQ776/PRO1570)
147122 100 µg

TMPRSS4, Control Peptide (Transmembrane Protease Serine 4, Channel-activating Protease 2, CAPH2, Membrane-type Serine Protease 2, MT-SP2, TMPRSS3, UNQ776/PRO1570)

Sign In for Pricing
View Details
HIV-p66 Protein (N-His, HIV)
P525305 100 µg

HIV-p66 Protein (N-His, HIV)

Sign In for Pricing
View Details
Phospho-TrkC (Tyr516) Blocking Peptide
MBS9615931-01 1 mg

Phospho-TrkC (Tyr516) Blocking Peptide

Sign In for Pricing
View Details
Phospho-TrkC (Tyr516) Blocking Peptide
MBS9615931-02 5x 1 mg

Phospho-TrkC (Tyr516) Blocking Peptide

Sign In for Pricing
View Details
OR52B2 Antibody Blocking Peptide
orb1509991 500 µg

OR52B2 Antibody Blocking Peptide

Sign In for Pricing
View Details