What is the catalog number for DEFB104A?

The catalog number for DEFB104A is CSB-CL840974HU.

What sizes are available for DEFB104A?

DEFB104A is available in the following size(s): 10 μg Plasmid + 200 μL Glycerol.

Is DEFB104A in stock?

DEFB104A is currently made to order / not held in immediate stock. Contact us for lead time.

Who manufactures DEFB104A?

DEFB104A is manufactured by Cusabio.

What is the estimated delivery time for DEFB104A?

Estimated delivery time for DEFB104A is approximately 15 business day(s), depending on your location.

DEFB104A

Product Specifications

Sequence

ATGCAGAGACTTGTGCTGCTATTAGCCATTTCTCTTCTACTCTATCAAGATCTTCCAGTGAGAAGCGAATTTGAATTGGACAGAATATGTGGTTATGGGACTGCCCGTTGCCGGAAGAAATGTCGCAGCCAAGAATACAGAATTGGAAGATGTCCCAACACCTATGCATGCTGTTTGAGAAAATGGGATGAGAGCTTACTGAATCGTACAAAACCCTGA

Length

219

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

orb2875044 100 µL

NLE1 Rabbit pAb, IRDye 800CW conjugated

Sign In for Pricing

View Details

sc-420230-LAC-2 200 µL

AMZ2 Lentiviral Activation Particles (m2)

Sign In for Pricing

View Details

orb1624848 100 µL

LIG4 Conjugated Antibody

Sign In for Pricing

View Details

K2419508 1.0 µg DNA

TNNI2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

Sign In for Pricing

View Details

KN500548 1 Kit

A430033K04Rik Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing

View Details

orb497146 100 µL

CBX1 Rabbit Polyclonal Antibody (PE)

Sign In for Pricing

View Details