Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

DEFB104A

Product Specifications

Sequence

ATGCAGAGACTTGTGCTGCTATTAGCCATTTCTCTTCTACTCTATCAAGATCTTCCAGTGAGAAGCGAATTTGAATTGGACAGAATATGTGGTTATGGGACTGCCCGTTGCCGGAAGAAATGTCGCAGCCAAGAATACAGAATTGGAAGATGTCCCAACACCTATGCATGCTGTTTGAGAAAATGGGATGAGAGCTTACTGAATCGTACAAAACCCTGA

Length

219

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Human Immunoglobulin J chain (IGJ)
MBS950938-01 0.02 mg (E-Coli)

Recombinant Human Immunoglobulin J chain (IGJ)

Sign In for Pricing
View Details
Recombinant Human Immunoglobulin J chain (IGJ)
MBS950938-02 0.02 mg (Yeast)

Recombinant Human Immunoglobulin J chain (IGJ)

Sign In for Pricing
View Details
Recombinant Human Immunoglobulin J chain (IGJ)
MBS950938-03 0.1 mg (E-Coli)

Recombinant Human Immunoglobulin J chain (IGJ)

Sign In for Pricing
View Details
Recombinant Human Immunoglobulin J chain (IGJ)
MBS950938-04 0.1 mg (Yeast)

Recombinant Human Immunoglobulin J chain (IGJ)

Sign In for Pricing
View Details
Recombinant Human Immunoglobulin J chain (IGJ)
MBS950938-05 1 mg (E-Coli)

Recombinant Human Immunoglobulin J chain (IGJ)

Sign In for Pricing
View Details
Recombinant Human Immunoglobulin J chain (IGJ)
MBS950938-06 1 mg (Yeast)

Recombinant Human Immunoglobulin J chain (IGJ)

Sign In for Pricing
View Details