Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

KCTD11

Product Specifications

Sequence

ATGCTGGGGGCCATGTTTAGGGCCGGCACCCCCATGCCCCCCAACCTCAATTCCCAAGGAGGCGGCCACTACTTCATCGACCGGGATGGCAAGGCCTTCCGGCACATCCTCAATTTCCTGAGGCTGGGCCGCCTGGACCTGCCCCGTGGGTACGGAGAGACAGCGCTGCTCAGGGCAGAGGCTGACTTCTACCAGATCCGGCCCCTCCTGGACGCGCTGCGGGAACTGGAGGCCTCTCAGGGGACCCCTGCACCCACAGCTGCCCTGCTCCACGCAGATGTAGATGTCAGCCCCCGCCTGGTGCACTTCTCTGCTCGCCGGGGACCCCATCACTATGAGCTGAGCTCCGTCCAGGTGGACACCTTCCGAGCCAACCTTTTCTGCACCGACTCTGAGTGTCTAGGTGCTTTGCGGGCCCGATTTGGTGTGGCCAGTGGGGATAGGGCAGAGGGGAGCCCACATTTTCATCTGGAGTGGGCCCCCCGCCCCGTGGAACTCCCCGAGGTGGAGTATGGGAGACTGGGGCTGCAGCCGCTGTGGACTGGGGGGCCAGGAGAGCGGCGGGAGGTGGTGGGCACCCCAAGCTTCCTGGAGGAGGTGCTGCGGGTGGCTCTCGAGCACGGCTTCCGACTAGACTCTGTCTTCCCCGACCCCGAAGACCTGCTCAACTCCAGGTCTCTGCGCTTTGTCCGGCACTGA

Length

699

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Bacillus anthracis Elongation factor Tu (tuf)
MBS1186190-01 0.02 mg (E-Coli)

Recombinant Bacillus anthracis Elongation factor Tu (tuf)

Sign In for Pricing
View Details
Recombinant Bacillus anthracis Elongation factor Tu (tuf)
MBS1186190-02 0.02 mg (Yeast)

Recombinant Bacillus anthracis Elongation factor Tu (tuf)

Sign In for Pricing
View Details
Recombinant Bacillus anthracis Elongation factor Tu (tuf)
MBS1186190-03 0.1 mg (E-Coli)

Recombinant Bacillus anthracis Elongation factor Tu (tuf)

Sign In for Pricing
View Details
Recombinant Bacillus anthracis Elongation factor Tu (tuf)
MBS1186190-04 0.1 mg (Yeast)

Recombinant Bacillus anthracis Elongation factor Tu (tuf)

Sign In for Pricing
View Details
Recombinant Bacillus anthracis Elongation factor Tu (tuf)
MBS1186190-05 0.02 mg (Baculovirus)

Recombinant Bacillus anthracis Elongation factor Tu (tuf)

Sign In for Pricing
View Details
Recombinant Bacillus anthracis Elongation factor Tu (tuf)
MBS1186190-06 0.02 mg (Mammalian-Cell)

Recombinant Bacillus anthracis Elongation factor Tu (tuf)

Sign In for Pricing
View Details